TF sequence records
Human UniProt records selected for transcription and DNA-binding annotations, after filtering non-TF DNA-associated proteins such as repair, recombination, replication, modification and nucleosome-related proteins.
Help
ModCRE DB Help
ModCRE DB is a searchable human transcription-factor motif resource. It links UniProt sequence records to Known motif databases, nearest-neighbour PWM transfer, generated PWM files, DNA-scan results and TF-DNA structural models.
What the database contains
Motif assignments
Known motifs from JASPAR, CisBP and HOCOMOCO; transferred motifs from nearest neighbours; and structure-derived ModCRE predictions. For ModCRE entries, structural provenance is reported separately as Homology model or AlphaFold3 model.
Files and models
Generated PWM matrices, MEME motif files, sequence-logo data, TF-motif links, DNA-binding regions, PFAM/domain annotations and indexed 3D model files where available.
Construction workflow
1. Human TF recordsUniProt sequence records selected by transcription/DNA-binding annotation and filtered against non-TF DNA-associated functions.
2. Known motifsDirect motif matches from JASPAR, CisBP and HOCOMOCO are assigned first.
3. Nearest neighboursUnassigned records are compared with motif-bearing TFs and split into >70% and 50–70% identity transfer categories.
4. Structural motifsRemaining modellable records are processed with ModCRE. The structural source is tracked separately as a Homology model or, for unresolved cases, an AlphaFold3 TF-DNA model after interface checks.
5. Web outputsThe web database exposes TF pages, motif pages, generated PWMs, scan results, model files and source links.
How to search
By TF or accession
Use a gene name, protein name or UniProt accession to find the TF record and its motif/model annotations.
By family or domain
Use a TF family, DNA-binding domain or PFAM identifier to recover groups of related TF records.
By motif or source
Use a motif identifier or source name to inspect the motif page and the TF records linked to that motif.
What each page outputs
Search resultsMatching TF records, motif records and domain/family hits, with links to the corresponding detail pages.
TF pageUniProt metadata, primary motif category, motif assignments, generated PWM status, sequence-logo/motif links, DNA-binding regions, PFAM/domain annotations and 3D model files.
Motif pageMotif source, motif identifier, matrix information, downloadable MEME file and TF records using that motif.
Scan DNARanked motif hits in the submitted DNA sequence, including source, category, position, strand, matched sequence, score and p-value.
3D model linksIndexed model files and model-supported regions for structure-based ModCRE predictions, with Homology model or AlphaFold3 model provenance where applicable.
Motif categories
Motif assigned from a direct match in JASPAR, CisBP or HOCOMOCO.
Motif transferred from a closely related motif-bearing TF.
Motif transferred from a more distant annotated TF and kept as a lower-confidence assignment.
PWM predicted by ModCRE from a TF-DNA structural model. Structural source is reported separately as Homology model or AlphaFold3 model.
The strongest available category is used as the primary prediction for a TF record. Supporting motif links and model files can still appear on detail pages without changing that primary prediction.
Scan DNA
Input
Paste DNA or FASTA sequence. Scan against a TF-specific motif set, selected motif IDs or the generated-PWM collection with optional source/category filters.
>p53_site_test
TTTTTTGAACATGTCCCAACATGTTGTTTTTT
Output
Each hit links the matched motif back to the TF and motif records used for the scan.
| TF | Motif | Category | Position | Strand | p-value |
|---|---|---|---|---|---|
| TP53 | source|motif_id | Known | 7–26 | + | reported by scan |
Sources and methods
Motif databases
Known motif assignments are integrated from public PWM resources.
Sequence and domains
UniProt provides sequence records and protein metadata. PFAM/domain annotations support family-level search and interpretation.
Structure-derived motifs
ModCRE predicts PWMs from TF-DNA structural models. Model provenance is tracked separately: Homology model for ModCRE homology models and AlphaFold3 model for validated AF3 TF-DNA structures.
Release summary
5288TF records with motif annotation
117290TF-motif assignments
24039Generated PWM matrices
26330Motif files
148253D model files
12453Motif-structure links