Region 228-249 0 PWM
- Residues
- 22 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 1 active PDB
- Templates
- 1FJL
- Sources
- Structure model
Transcription factor
A0A024R531 - PAX8
Paired box protein Pax-8
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 387 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M05685_2.00 | Known | CisBP | GGCGCAGTCATGCGTGACGG | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
387 aa
228-249
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 228-2491 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_A0A024R531:228:249_1fjl_B_1 | 1fjl | 228-249 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 9-133 | PF00292 | 'Paired box' domain | No overlap with loaded model regions |
| 282-386 | PF12403 | Paired-box protein 2 C terminal | No overlap with loaded model regions |