ModCRE DB

Transcription factor

A0A024R8F3 - GFI1B

Growth factor independent 1B transcriptional repressor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 352 aa

12 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)5
MotifPredictionSourceDNA bindingSupportLogoActions
M04524_2.00 NN 70+% CisBP TAAATCACTGCATTTCACTCA 93.7% identity Open · Scan
M08977_2.00 NN 70+% CisBP AAATCACAGC 82.6% identity Open · Scan
MA0483.1 NN 70+% JASPAR AAATCACAGCA 79.8% identity Open · Scan
MA0038.1 NN 70+% JASPAR CAAATCACTG 78.5% identity Open · Scan
MA0038.2 NN 70+% JASPAR CAAATCACTGCA 78.5% identity Open · Scan
Nearest Neighbor (70% - 40%)7
MotifPredictionSourceDNA bindingSupportLogoActions
M00769_2.00 NN 70-40% CisBP ACTCCCCC 55.1% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 54.7% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 52.1% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 50.9% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.9% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.0% identity Open · Scan
M01529_2.00 NN 70-40% CisBP CCCCGCATT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 352 aa
155-346

Region 155-346 0 PWM

Residues
192 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 155-3461 model
Actions
Predicted = Low TFS_A0A024R8F3:155:346_5wjq_D_1 5wjq 155-346 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
163-186PF00096Zinc finger, C2H2 typeoverlaps 155-346
192-214PF00096Zinc finger, C2H2 typeoverlaps 155-346
242-264PF00096Zinc finger, C2H2 typeoverlaps 155-346
270-292PF00096Zinc finger, C2H2 typeoverlaps 155-346
298-320PF00096Zinc finger, C2H2 typeoverlaps 155-346
326-349PF00096Zinc finger, C2H2 typeoverlaps 155-346