ModCRE DB

Transcription factor

A0A0A0MRS1 - ZNF33A

Zinc finger protein 33A

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 699 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M08263_2.00 Known CisBP ATCTCGGCACTTTGGGAGGCCA Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 699 aa
218-377

Region 218-377 0 PWM

Residues
160 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 218-3771 model
Actions
Predicted = Low TFS_A0A0A0MRS1:218:377_5t0u_A_1 5t0u 218-377 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
217-239PF00096Zinc finger, C2H2 typeoverlaps 218-377
245-267PF00096Zinc finger, C2H2 typeoverlaps 218-377
273-295PF00096Zinc finger, C2H2 typeoverlaps 218-377
301-323PF00096Zinc finger, C2H2 typeoverlaps 218-377
329-351PF00096Zinc finger, C2H2 typeoverlaps 218-377
357-379PF00096Zinc finger, C2H2 typeoverlaps 218-377
385-407PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
413-435PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
441-463PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
469-491PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
497-519PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
525-547PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
553-575PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
581-603PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
610-631PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
637-659PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions