Region 565-716 0 PWM
- Residues
- 152 aa
- Domains
- PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger
- 3D models
- 1 active PDB
- Templates
- 2I13
- Sources
- Structure model
Transcription factor
A0A0C4DFM2 - ZNF574
Zinc finger protein 574
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 986 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M08239_2.00 | Known | CisBP | GGGCCGCTCTAGGCTGCCGG | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
986 aa
565-716
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 565-7161 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_A0A0C4DFM2:565:716_2i13_A_1 | 2i13 | 565-716 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 399-422 | PF12874 | Zinc-finger of C2H2 type | No overlap with loaded model regions |
| 426-448 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 585-607 | PF00096 | Zinc finger, C2H2 type | overlaps 565-716 |
| 613-635 | PF00096 | Zinc finger, C2H2 type | overlaps 565-716 |
| 641-663 | PF00096 | Zinc finger, C2H2 type | overlaps 565-716 |
| 669-691 | PF13912 | C2H2-type zinc finger | overlaps 565-716 |
| 829-850 | PF13912 | C2H2-type zinc finger | No overlap with loaded model regions |
| 856-878 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 912-934 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |