ModCRE DB

Transcription factor

A0A0C4DG08 - ZNF780A

Zinc finger protein 780A

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 607 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07729_2.00 Known CisBP CCAGACTGCCTGCCAAAACCCCCT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 607 aa
127-406

Region 127-406 0 PWM

Residues
280 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 127-4061 model
Actions
Predicted = Low TFS_A0A0C4DG08:127:406_5wjq_D_1 5wjq 127-406 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
131-153PF00096Zinc finger, C2H2 typeoverlaps 127-406
159-181PF00096Zinc finger, C2H2 typeoverlaps 127-406
187-209PF00096Zinc finger, C2H2 typeoverlaps 127-406
215-237PF00096Zinc finger, C2H2 typeoverlaps 127-406
243-265PF00096Zinc finger, C2H2 typeoverlaps 127-406
299-321PF00096Zinc finger, C2H2 typeoverlaps 127-406
327-349PF00096Zinc finger, C2H2 typeoverlaps 127-406
355-377PF00096Zinc finger, C2H2 typeoverlaps 127-406
383-405PF00096Zinc finger, C2H2 typeoverlaps 127-406
439-461PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
467-489PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
495-517PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
523-545PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
551-573PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
579-601PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions