Region 192-345 0 PWM
- Residues
- 154 aa
- Domains
- PF00157 · Pou domain - N-terminal to homeobox domain PF00046 · Homeodomain
- 3D models
- 1 active PDB
- Templates
- 5WC9
- Sources
- Structure model
Transcription factor
A0A0C4DG88 - POU2F1
POU domain protein
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 561 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M10829_2.00 | Known | CisBP | ATATAATTATGCAAATTAAAAGA | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
561 aa
192-345
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 192-3451 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_A0A0C4DG88:192:345_5wc9_A_1 | 5wc9 | 192-345 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 192-262 | PF00157 | Pou domain - N-terminal to homeobox domain | overlaps 192-345 |
| 288-344 | PF00046 | Homeodomain | overlaps 192-345 |
| 355-550 | PF19536 | POU domain, class 2, transcription factor 1 C-terminal | No overlap with loaded model regions |