ModCRE DB

Transcription factor

A0A0C4DGN9 - IKZF3

IKAROS family zinc finger 3

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 207 aa

15 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08320_2.00 NN 70+% CisBP TTCCCTGCC 70.7% identity Open · Scan
Nearest Neighbor (70% - 40%)14
MotifPredictionSourceDNA bindingSupportLogoActions
M07761_2.00 NN 70-40% CisBP CTGATTATTCACCCA 58.6% identity Open · Scan
M04475_2.00 NN 70-40% CisBP GATGCACGTACCGTGCCTCA 57.5% identity Open · Scan
M10303_2.00 NN 70-40% CisBP TACTGGGAATACC 54.7% identity Open · Scan
M00149_2.00 NN 70-40% CisBP CGTACGCC 54.3% identity Open · Scan
M00780_2.00 NN 70-40% CisBP GACCCCCCGG 50.0% identity Open · Scan
M02643_2.00 NN 70-40% CisBP GACCACCCACG 50.0% identity Open · Scan
M07687_2.00 NN 70-40% CisBP ACAAATAAGGTTCTTGTGCCCCCTGCT 50.0% identity Open · Scan
M08291_2.00 NN 70-40% CisBP AATCCAGCCCTAGACTCTCCC 50.0% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 50.0% identity Open · Scan
M09013_2.00 NN 70-40% CisBP GGCCCCCTGCTGTGA 50.0% identity Open · Scan
MA0696.1 NN 70-40% JASPAR GACCCCCCGCTGTG 50.0% identity Open · Scan
MA0697.1 NN 70-40% JASPAR GACCCCCCGCTGCGC 50.0% identity Open · Scan
MA1584.1 NN 70-40% JASPAR CGACCCCCCGCTGTGC 50.0% identity Open · Scan
MA1628.1 NN 70-40% JASPAR CACAGCAGGGG 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 207 aa
104-165

Region 104-165 0 PWM

Residues
62 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
2I13
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 104-1651 model
Actions
Predicted = Low TFS_A0A0C4DGN9:104:165_2i13_A_1 2i13 104-165 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
146-165PF00096Zinc finger, C2H2 typeoverlaps 104-165