ModCRE DB

Transcription factor

A0A0C4DGR5 - ZNF496

Zinc finger protein 496

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 512 aa

12 Generated PWM 24 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE12
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:358:421_1llm_D_1 ModCRE Homology model GTCGCGCGGAAA Region 358-421 · 1 3D model Open · Scan
TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:313:410_5ei9_E_1 ModCRE Homology model TCCCCCGGGGGGGTGGG Region 313-410 · 1 3D model Open · Scan
TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:324:500_5v3j_E_1 ModCRE Homology model GTGGGGGGGCCTGGGGGGGGAC Region 324-500 · 1 3D model Open · Scan
TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:324:500_5v3m_C_1 ModCRE Homology model TGGGGGTGCAGGTGGGGGCACG Region 324-500 · 1 3D model Open · Scan
TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:326:500_5wjq_D_1 ModCRE Homology model CCGTGGGGAGCTTGGGGCGGGGGC Region 326-500 · 1 3D model Open · Scan
TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:329:466_2i13_A_1 ModCRE Homology model AAAAAAAAGGTTAGTATCCCC Region 329-466 · 1 3D model Open · Scan
a0a0c4dgr5.af3.0 ModCRE AlphaFold3 model GCGCGGCCCCCCGGGTCCCCGCGTA AlphaFold3 model · ModCRE PWM Open · Scan
a0a0c4dgr5.af3.1 ModCRE AlphaFold3 model GGGGGGGGGGGCCCGGATGAGACCGGCTGC AlphaFold3 model · ModCRE PWM Open · Scan
a0a0c4dgr5.af3.2 ModCRE AlphaFold3 model GGGGGGGCCACCGGGACCCTCCGGGGCAGC AlphaFold3 model · ModCRE PWM Open · Scan
a0a0c4dgr5.af3.3 ModCRE AlphaFold3 model CCCGGGGGGGGCCCCGGG AlphaFold3 model · ModCRE PWM Open · Scan
a0a0c4dgr5.af3.4 ModCRE AlphaFold3 model GCGCGGCCCCCCGGGTCCCCGCGTA AlphaFold3 model · ModCRE PWM Open · Scan
a0a0c4dgr5.af3.5 ModCRE AlphaFold3 model GGGGCCCCGGTTTGGGGGGGCGGG AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 512 aa
313-500

Region 313-500 6 PWM

Residues
188 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
24 active PDB models 6 summary rows
Region 313-5006 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:358:421_1llm_D_1 1llm 358-421 View model · PDB
Predicted = Low TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:313:410_5ei9_E_1 5ei9 313-410 View model · PDB
Predicted = Low TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:324:500_5v3j_E_1 5v3j 324-500 View model · PDB
Predicted = Low TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:324:500_5v3m_C_1 5v3m 324-500 View model · PDB
Predicted = Low TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:326:500_5wjq_D_1 5wjq 326-500 View model · PDB
Predicted = Low TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:329:466_2i13_A_1 2i13 329-466 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 5ei9 313:504 313 410 P:E · DNA:A,B 39.8% / 54.1% 87 View · PDB TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:313:410_5ei9_E_1
1 2i13 313:504 329 466 P:A · DNA:C,D 35.5% / 50.0% 88 View · PDB TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:329:466_2i13_A_1
1 1llm 313:504 358,358 421,421 P:C,D · DNA:A,B 35.4% / 52.3% 73,75 View · PDB DIMER_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:358:421_1llm_D_1
3 5v3m 313:504 324 500 P:C · DNA:A,B 32.8% / 48.0% 61 View · PDB TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:324:500_5v3m_C_1
4 5v3j 313:504 324 500 P:E · DNA:A,B 32.8% / 48.0% 61 View · PDB TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:324:500_5v3j_E_1
2 5wjq 313:504 326 500 P:D · DNA:A,B 32.6% / 52.0% 59 View · PDB TFS_tr_A0A0C4DGR5_A0A0C4DGR5_HUMAN:326:500_5wjq_D_1
Full sequence / unlocalized models18 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a0c4dgr5.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5.af3.5-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_dimer.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_dimer.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_dimer.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_dimer.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_dimer.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_dimer.af3.5-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_monomer.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_monomer.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_monomer.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_monomer.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_monomer.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0c4dgr5_monomer.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
148-173PF01352KRAB boxNo overlap with loaded model regions
331-351PF00096Zinc finger, C2H2 typeoverlaps 313-500
388-410PF00096Zinc finger, C2H2 typeoverlaps 313-500
478-500PF00096Zinc finger, C2H2 typeoverlaps 313-500