Transcription factor

A0A0D9SEN7 - RUNX2

Runt-related transcription factor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 485 aa

9 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3

Motif	Prediction	Source	DNA binding	Support	Actions
M05733_2.00	NN 70+%	CisBP	CTAACCGCAAAAACCGCAAC	95.6% identity	Open · Scan
MA0511.1	NN 70+%	JASPAR	GGGGTTTGTGGTTTG	95.6% identity	Open · Scan
M01307_2.00	NN 70+%	CisBP	TTAACCGCAA	75.6% identity	Open · Scan

Nearest Neighbor (70% - 40%)6

Motif	Prediction	Source	DNA binding	Support	Actions
M06444_2.00	NN 70-40%	CisBP	TAACCGCAA	68.0% identity	Open · Scan
MA0002.1	NN 70-40%	JASPAR	TATTGTGGTTA	63.0% identity	Open · Scan
M02457_2.00	NN 70-40%	CisBP	ATAACCGCAAT	58.5% identity	Open · Scan
M09371_2.00	NN 70-40%	CisBP	GAAACCACAGA	56.6% identity	Open · Scan
MA0684.1	NN 70-40%	JASPAR	AAACCGCAAA	56.0% identity	Open · Scan
M05731_2.00	NN 70-40%	CisBP	CAAACCGCAAAAACCGCAAG	55.6% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 485 aa

87-214

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 87-2141 model

				Actions
Predicted = Low	TFS_A0A0D9SEN7:87:214_4l0y_A_1	4l0y	87-214	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
89-216	PF00853	Runt domain	overlaps 87-214
394-485	PF08504	Runx inhibition domain	No overlap with loaded model regions