ModCRE DB

Transcription factor

A0A0D9SET2 - MEF2C

Myocyte enhancer factor 2C

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 205 aa

19 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)5
MotifPredictionSourceDNA bindingSupportLogoActions
MA0497.1 NN 70+% JASPAR ATGCTAAAAATAGAA 87.4% identity Open · Scan
M05557_2.00 NN 70+% CisBP CCAAATATGG 85.7% identity Open · Scan
MA0660.1 NN 70+% JASPAR GCTATAAATAGC 85.7% identity Open · Scan
MA0773.1 NN 70+% JASPAR ACTATAAATAGA 75.1% identity Open · Scan
MA0052.1 NN 70+% JASPAR CTATTTATAG 74.2% identity Open · Scan
Nearest Neighbor (70% - 40%)14
MotifPredictionSourceDNA bindingSupportLogoActions
M10936_2.00 NN 70-40% CisBP TCCGGTGCTAAAAATAGCACCT 65.5% identity Open · Scan
M08214_2.00 NN 70-40% CisBP CTAAAAATAA 64.5% identity Open · Scan
M02697_2.00 NN 70-40% CisBP CCAAAAATGGAAAT 60.8% identity Open · Scan
M06985_2.00 NN 70-40% CisBP CCAAAAAAGGAAAGT 60.6% identity Open · Scan
M10909_2.00 NN 70-40% CisBP ATTACCATATATAGTAAT 60.0% identity Open · Scan
M08587_2.00 NN 70-40% CisBP TTACCTATAATTAAATTAGCA 59.0% identity Open · Scan
M08144_2.00 NN 70-40% CisBP CCAAAAAAGGAAA 55.4% identity Open · Scan
M10923_2.00 NN 70-40% CisBP ATTACCAAATTGGGAAAT 54.4% identity Open · Scan
M08143_2.00 NN 70-40% CisBP CCAAAAATGGA 54.2% identity Open · Scan
M02694_2.00 NN 70-40% CisBP ATTGCCAAATTGGGTAAG 53.6% identity Open · Scan
M08425_2.00 NN 70-40% CisBP CCAAAAATGGAAAAA 52.1% identity Open · Scan
M06989_2.00 NN 70-40% CisBP TTACCAAAAATGGAAAAA 50.7% identity Open · Scan
M06982_2.00 NN 70-40% CisBP TTCCAAAAATGGAAA 50.0% identity Open · Scan
M06993_2.00 NN 70-40% CisBP ACTTTCCAAAAAAGGAAAGTT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 205 aa
2-72

Region 2-72 0 PWM

Residues
71 aa
Domains
PF00319 · SRF-type transcription factor (DNA-binding and dimerisation domain)
3D models
1 active PDB
Templates
3MU6
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 2-721 model
Actions
Predicted = Low DIMER_A0A0D9SET2:2:72_3mu6_B_1 3mu6 2-72 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
10-57PF00319SRF-type transcription factor (DNA-binding and dimerisation domain)overlaps 2-72
95-152PF12347Holliday junction regulator protein family C-terminal repeatNo overlap with loaded model regions