ModCRE DB

Transcription factor

A0A0J9YX80 - DEAF1

DEAF1 transcription factor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 147 aa

9 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07544_2.00 NN 70-40% CisBP CACGAA 54.3% identity Open · Scan
ModCRE8
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_A0A0J9YX80_A0A0J9YX80_HUMAN:86:134_4iqr_B_1 ModCRE Homology model CTGAGTGATCAATGATCAA Region 86-134 · 1 3D model Open · Scan
TFS_tr_A0A0J9YX80_A0A0J9YX80_HUMAN:86:134_4iqr_B_1 ModCRE Homology model GTGATCATTGATCACTCCG Region 86-134 · 1 3D model Open · Scan
a0a0j9yx80.af3.0 ModCRE AlphaFold3 model CACAACCCGACGTGCCCCCGGCA AlphaFold3 model · ModCRE PWM Open · Scan
a0a0j9yx80.af3.1 ModCRE AlphaFold3 model CACAACCCGACGTGCCCCCGGCA AlphaFold3 model · ModCRE PWM Open · Scan
a0a0j9yx80.af3.2 ModCRE AlphaFold3 model TTTTTTTTTTTATTTG AlphaFold3 model · ModCRE PWM Open · Scan
a0a0j9yx80.af3.3 ModCRE AlphaFold3 model AACCCGGGGCAGCGCCCAAATAAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a0j9yx80.af3.4 ModCRE AlphaFold3 model GGGGGCGGCCAAAAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a0j9yx80.af3.5 ModCRE AlphaFold3 model GGGGCGCCCCGCCCTTC AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 147 aa
86-134

Region 86-134 2 PWM

Residues
49 aa
Domains
PF01753 · MYND finger
3D models
2 active PDBs · 2 summary rows
Templates
4IQR
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 2 summary rows
Region 86-1342 models · 2 summary rows
Actions
Predicted = Low DIMER_tr_A0A0J9YX80_A0A0J9YX80_HUMAN:86:134_4iqr_B_1 4iqr 86-134 View model · PDB
Predicted = Low TFS_tr_A0A0J9YX80_A0A0J9YX80_HUMAN:86:134_4iqr_B_1 4iqr 86-134 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 4iqr 86:134 86,86 134,134 P:A,B · DNA:C,D 28.6% / 40.8% 16,15 View · PDB DIMER_tr_A0A0J9YX80_A0A0J9YX80_HUMAN:86:134_4iqr_B_1
1 4iqr 86:134 86,86 134,134 P:A,B · DNA:C,D 28.6% / 40.8% 16,15 View · PDB TFS_tr_A0A0J9YX80_A0A0J9YX80_HUMAN:86:134_4iqr_B_1
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a0j9yx80.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0j9yx80.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0j9yx80.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0j9yx80.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0j9yx80.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a0j9yx80.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
86-122PF01753MYND fingeroverlaps 86-134