Transcription factor

A0A0S2Z4E5 - TEAD4

TEA domain family member 4 isoform 3

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 238 aa

9 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M11400_2.00	NN 70+%	CisBP	AGCACAGGAATGCAAAAGG	80.6% identity		Open · Scan

Nearest Neighbor (70% - 40%)8

Motif	Prediction	Source	DNA binding	Support	Actions
M08610_2.00	NN 70-40%	CisBP	TATATCAAGAATGTTGGTTG	66.6% identity	Open · Scan
M09435_2.00	NN 70-40%	CisBP	ATGCCAGGAATGT	65.9% identity	Open · Scan
MA0809.1	NN 70-40%	JASPAR	CACATTCCAT	65.9% identity	Open · Scan
M03995_2.00	NN 70-40%	CisBP	TGGAATGCGG	58.4% identity	Open · Scan
MA0090.1	NN 70-40%	JASPAR	CACATTCCTCCG	55.9% identity	Open · Scan
M05826_2.00	NN 70-40%	CisBP	TGGAATGCG	53.5% identity	Open · Scan
M03576_2.00	NN 70-40%	CisBP	TGGAATGT	52.1% identity	Open · Scan
MA0808.1	NN 70-40%	JASPAR	ACATTCCA	52.1% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 238 aa

1-39

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 1-391 model

				Actions
Predicted = Low	TFS_A0A0S2Z4E5:1:39_5nnx_A_1	5nnx	1-39	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
2-33	PF01285	TEA/ATTS domain	overlaps 1-39
47-235	PF17725	YAP binding domain	No overlap with loaded model regions