ModCRE DB

Transcription factor

A0A140VKG3

Testis tissue sperm-binding protein Li 80P

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 459 aa

10 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M03686_2.00 NN 70+% CisBP TGATTGCTCTTTT 88.0% identity Open · Scan
Nearest Neighbor (70% - 40%)9
MotifPredictionSourceDNA bindingSupportLogoActions
M08889_2.00 NN 70-40% CisBP GCTGCTCTTTTT 57.9% identity Open · Scan
M08934_2.00 NN 70-40% CisBP GCTGTACCTGCTTATTAGGC 53.4% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 52.9% identity Open · Scan
M07714_2.00 NN 70-40% CisBP AGCCCATTGGGGCCTATGCCC 52.4% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.6% identity Open · Scan
M06108_2.00 NN 70-40% CisBP ACAACAACAAC 50.4% identity Open · Scan
M00609_2.00 NN 70-40% CisBP GGAAGCCCTA 50.0% identity Open · Scan
M04409_2.00 NN 70-40% CisBP GGCGGCCATTTTGG 50.0% identity Open · Scan
M08529_2.00 NN 70-40% CisBP TGCCAAG 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 459 aa
275-384

Region 275-384 0 PWM

Residues
110 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 275-3841 model
Actions
Predicted = Low TFS_A0A140VKG3:275:384_5egb_A_1 5egb 275-384 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
277-296PF00096Zinc finger, C2H2 typeoverlaps 275-384
305-327PF00096Zinc finger, C2H2 typeoverlaps 275-384
333-355PF00096Zinc finger, C2H2 typeoverlaps 275-384
361-383PF00096Zinc finger, C2H2 typeoverlaps 275-384
389-413PF13912C2H2-type zinc fingerNo overlap with loaded model regions
417-440PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions