Transcription factor

A0A1B0GTD0 - GFI1B

Growth factor independent 1B transcriptional repressor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 362 aa

13 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)5

Motif	Prediction	Source	DNA binding	Support	Actions
M04524_2.00	NN 70+%	CisBP	TAAATCACTGCATTTCACTCA	91.1% identity	Open · Scan
M08977_2.00	NN 70+%	CisBP	AAATCACAGC	80.4% identity	Open · Scan
MA0483.1	NN 70+%	JASPAR	AAATCACAGCA	77.6% identity	Open · Scan
MA0038.1	NN 70+%	JASPAR	CAAATCACTG	74.6% identity	Open · Scan
MA0038.2	NN 70+%	JASPAR	CAAATCACTGCA	74.6% identity	Open · Scan

Nearest Neighbor (70% - 40%)8

Motif	Prediction	Source	DNA binding	Support	Actions
M00769_2.00	NN 70-40%	CisBP	ACTCCCCC	55.1% identity	Open · Scan
M00955_2.00	NN 70-40%	CisBP	ACGTCCTCT	54.7% identity	Open · Scan
M01456_2.00	NN 70-40%	CisBP	GTGATCGGCG	52.1% identity	Open · Scan
M01474_2.00	NN 70-40%	CisBP	CGCCGATCAC	50.9% identity	Open · Scan
M04611_2.00	NN 70-40%	CisBP	CTTTCGGACAC	50.9% identity	Open · Scan
M00939_2.00	NN 70-40%	CisBP	CCACCTCA	50.0% identity	Open · Scan
M01529_2.00	NN 70-40%	CisBP	CCCCGCATT	50.0% identity	Open · Scan
MA1646.1	NN 70-40%	JASPAR	AAACAGAAGCAG	50.0% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 362 aa

155-356

Residues: 202 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 155-3561 model

				Actions
Predicted = Low	TFS_A0A1B0GTD0:155:356_5wjq_D_1	5wjq	155-356	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
163-186	PF00096	Zinc finger, C2H2 type	overlaps 155-356
192-214	PF00096	Zinc finger, C2H2 type	overlaps 155-356
252-274	PF00096	Zinc finger, C2H2 type	overlaps 155-356
280-302	PF00096	Zinc finger, C2H2 type	overlaps 155-356
308-330	PF00096	Zinc finger, C2H2 type	overlaps 155-356
336-359	PF00096	Zinc finger, C2H2 type	overlaps 155-356