Region 82-148 0 PWM
- Residues
- 67 aa
- Domains
- PF00447 · HSF-type DNA-binding
- 3D models
- 1 active PDB
- Templates
- 5D5V
- Sources
- Structure model
Transcription factor
A0A1B0GTS1 - HSFX4
Heat shock transcription factor, X-linked member 4
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 333 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M08586_2.00 | NN 70+% | CisBP | TTTTATTTCTTCTATTCTCTA | 70.0% identity | Open · Scan |
Nearest Neighbor (70% - 40%)1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M05511_2.00 | NN 70-40% | CisBP | ATTCGAACGTTTCGAACGC | 57.3% identity | Open · Scan |
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
333 aa
82-148
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 82-1481 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_A0A1B0GTS1:82:148_5d5v_B_1 | 5d5v | 82-148 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 83-182 | PF00447 | HSF-type DNA-binding | overlaps 82-148 |