ModCRE DB

Transcription factor

A0A1B0GVI4 - MEF2C

Myocyte enhancer factor 2C

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 42 aa

10 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)6
MotifPredictionSourceDNA bindingSupportLogoActions
M10936_2.00 NN 70+% CisBP TCCGGTGCTAAAAATAGCACCT 78.0% identity Open · Scan
MA0052.1 NN 70+% JASPAR CTATTTATAG 78.0% identity Open · Scan
MA0497.1 NN 70+% JASPAR ATGCTAAAAATAGAA 78.0% identity Open · Scan
MA0773.1 NN 70+% JASPAR ACTATAAATAGA 73.1% identity Open · Scan
M05557_2.00 NN 70+% CisBP CCAAATATGG 70.7% identity Open · Scan
MA0660.1 NN 70+% JASPAR GCTATAAATAGC 70.7% identity Open · Scan
Nearest Neighbor (70% - 40%)4
MotifPredictionSourceDNA bindingSupportLogoActions
M08214_2.00 NN 70-40% CisBP CTAAAAATAA 68.2% identity Open · Scan
M02694_2.00 NN 70-40% CisBP ATTGCCAAATTGGGTAAG 51.2% identity Open · Scan
M08587_2.00 NN 70-40% CisBP TTACCTATAATTAAATTAGCA 51.2% identity Open · Scan
M10923_2.00 NN 70-40% CisBP ATTACCAAATTGGGAAAT 51.2% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 42 aa
2-42

Region 2-42 0 PWM

Residues
41 aa
Domains
PF00319 · SRF-type transcription factor (DNA-binding and dimerisation domain)
3D models
1 active PDB
Templates
1C7U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 2-421 model
Actions
Predicted = Low DIMER_A0A1B0GVI4:2:42_1c7u_B_1 1c7u 2-42 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
27-42PF00319SRF-type transcription factor (DNA-binding and dimerisation domain)overlaps 2-42