ModCRE DB

Transcription factor

A0A1W2PS25 - ZEB2

Zinc finger E-box binding homeobox 2

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 70 aa

11 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
M05844_2.00 NN 70+% CisBP TCACCTGT 73.4% identity Open · Scan
MA0103.1 NN 70+% JASPAR CACCTG 73.4% identity Open · Scan
MA0103.2 NN 70+% JASPAR CCTCACCTG 73.4% identity Open · Scan
Nearest Neighbor (70% - 40%)8
MotifPredictionSourceDNA bindingSupportLogoActions
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 63.6% identity Open · Scan
M06131_2.00 NN 70-40% CisBP ATGTCAAGCCCAAACAAAACCAAAA 62.5% identity Open · Scan
M07566_2.00 NN 70-40% CisBP TCAAACCATCCTTGC 56.0% identity Open · Scan
M06108_2.00 NN 70-40% CisBP ACAACAACAAC 54.1% identity Open · Scan
M06148_2.00 NN 70-40% CisBP AACAACACTA 54.1% identity Open · Scan
M08357_2.00 NN 70-40% CisBP GAGCCTGCTACTGAGCCTGGG 54.1% identity Open · Scan
M07631_2.00 NN 70-40% CisBP AATTTCAAAAATGCTATGGGC 51.7% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 70 aa
10-59

Region 10-59 0 PWM

Residues
50 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 10-591 model
Actions
Predicted = Low TFS_A0A1W2PS25:10:59_5v3j_E_1 5v3j 10-59 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Imported domain tags8
Rep_fac-A_CRibosomal_L37aezf-C2H2zf-C2H2_4zf-C2H2_6zf-C2H2_jazzf-H2C2_2zf-met