ModCRE DB

Transcription factor

A0A1X7SBT5 - GTF3A

Transcription factor IIIA

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 365 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08301_2.00 NN 70+% CisBP CTCCCATCC 98.6% identity Open · Scan
Nearest Neighbor (70% - 40%)7
MotifPredictionSourceDNA bindingSupportLogoActions
M08320_2.00 NN 70-40% CisBP TTCCCTGCC 54.3% identity Open · Scan
MA1508.1 NN 70-40% JASPAR GAAACAGGAAGT 52.1% identity Open · Scan
M01537_2.00 NN 70-40% CisBP TACCCCGCAC 51.4% identity Open · Scan
M04555_2.00 NN 70-40% CisBP GCCACGCCCCCGCCACGCCCAC 51.1% identity Open · Scan
MA1512.1 NN 70-40% JASPAR GCCACGCCCAC 51.1% identity Open · Scan
M03583_2.00 NN 70-40% CisBP GGATGCTGTG 50.9% identity Open · Scan
MA0741.1 NN 70-40% JASPAR GCCACGCCCCC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 365 aa
132-214

Region 132-214 0 PWM

Residues
83 aa
Domains
PF22110 · TFIIIA, beta-beta-alpha zinc finger
3D models
1 active PDB
Templates
1UN6
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 132-2141 model
Actions
Predicted = Low TFS_A0A1X7SBT5:132:214_1un6_B_1 1un6 132-214 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
70-94PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
100-125PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
178-208PF22110TFIIIA, beta-beta-alpha zinc fingeroverlaps 132-214
219-239PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
247-271PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
277-301PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions