Region 1-104 0 PWM
- Residues
- 104 aa
- Domains
- PF00870 · P53 DNA-binding domain
- 3D models
- 1 active PDB
- Templates
- 5LGY
- Sources
- Structure model
Transcription factor
Cellular tumor antigen p53
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 144 aa
Only entries with a generated matrix are shown here.
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M11197_2.00 | Known | CisBP | AGACATGCCCGGGCATGTCC | Direct PWM | Open · Scan |
No generated PWM in this category.
No generated PWM in this category.
No generated PWM in this category.
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_A0A218MJD5:1:104_5lgy_B_1 | 5lgy | 1-104 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 5-101 | PF00870 | P53 DNA-binding domain | overlaps 1-104 |