ModCRE DB

Transcription factor

A0A2R8YF72 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1207 aa

8 Generated PWM 20 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE8
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_A0A2R8YF72_A0A2R8YF72_HUMAN:879:953_2mf8_A_1 ModCRE Homology model TAAAACTTTTTAA Region 879-953 · 1 3D model Open · Scan
TFS_tr_A0A2R8YF72_A0A2R8YF72_HUMAN:923:953_2jx1_A_1 ModCRE Homology model GGCTTTAA Region 923-953 · 1 3D model Open · Scan
a0a2r8yf72.af3.0 ModCRE AlphaFold3 model CCACTCCCAACCGTTTGCGGTGCGGGCGGG AlphaFold3 model · ModCRE PWM Open · Scan
a0a2r8yf72.af3.1 ModCRE AlphaFold3 model GCAACACAGGTTTTTCAATAGAATTGGGGC AlphaFold3 model · ModCRE PWM Open · Scan
a0a2r8yf72.af3.2 ModCRE AlphaFold3 model TGTTAAAACGCCGCTAAAGTGCGGCGCGCA AlphaFold3 model · ModCRE PWM Open · Scan
a0a2r8yf72.af3.3 ModCRE AlphaFold3 model TTATAGTTATAAATATTTATAAAGTGTAAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a2r8yf72.af3.4 ModCRE AlphaFold3 model TTAATTAGATTACAATTATCTTTGCCGCGT AlphaFold3 model · ModCRE PWM Open · Scan
a0a2r8yf72.af3.5 ModCRE AlphaFold3 model CCACTCCCAACCGTTTGCGGTGCGGGCGGG AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1207 aa
879-953

Region 879-953 2 PWM

Residues
75 aa
Domains
PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type
3D models
2 active PDBs · 2 summary rows
Templates
2JX1, 2MF8
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
20 active PDB models 2 summary rows
Region 879-9532 models · 2 summary rows
Actions
Predicted = Low TFS_tr_A0A2R8YF72_A0A2R8YF72_HUMAN:879:953_2mf8_A_1 2mf8 879-953 View model · PDB
Predicted = Low TFS_tr_A0A2R8YF72_A0A2R8YF72_HUMAN:923:953_2jx1_A_1 2jx1 923-953 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 2jx1 879:953 923 953 P:A · DNA:B,C 96.8% / 100.0% 100 View · PDB TFS_tr_A0A2R8YF72_A0A2R8YF72_HUMAN:923:953_2jx1_A_1
1 2mf8 879:953 879 953 P:A · DNA:B,C 86.7% / 96.0% 100 View · PDB TFS_tr_A0A2R8YF72_A0A2R8YF72_HUMAN:879:953_2mf8_A_1
Full sequence / unlocalized models18 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a2r8yf72.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72.af3.5-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_dimer.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_dimer.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_dimer.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_dimer.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_dimer.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_dimer.af3.5-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_monomer.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_monomer.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_monomer.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_monomer.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_monomer.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a2r8yf72_monomer.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
31-58PF01530Zinc finger, C2HC typeNo overlap with loaded model regions
505-531PF01530Zinc finger, C2HC typeNo overlap with loaded model regions
549-577PF01530Zinc finger, C2HC typeNo overlap with loaded model regions
621-872PF08474Myelin transcription factor 1No overlap with loaded model regions
882-909PF01530Zinc finger, C2HC typeoverlaps 879-953
925-953PF01530Zinc finger, C2HC typeoverlaps 879-953
974-1002PF01530Zinc finger, C2HC typeNo overlap with loaded model regions
1028-1055PF01530Zinc finger, C2HC typeNo overlap with loaded model regions