ModCRE DB

Transcription factor

A0A2R8YFL0 - CTCF

Transcriptional repressor CTCF (11-zinc finger protein) (CCCTC-binding factor) (CTCFL paralog)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 725 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA0139.1 NN 70+% JASPAR TGGCCACCAGGGGGCGCTA 99.7% identity Open · Scan
M08966_2.00 NN 70+% CisBP CCAGCGCCCCCTGGTGGCCA 97.6% identity Open · Scan
Nearest Neighbor (70% - 40%)6
MotifPredictionSourceDNA bindingSupportLogoActions
M08089_2.00 NN 70-40% CisBP GGTGCCCCCTGGTG 69.7% identity Open · Scan
MA1102.1 NN 70-40% JASPAR CACCAGGGGGCACC 68.4% identity Open · Scan
M01186_2.00 NN 70-40% CisBP TACCCCGCAC 52.9% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 50.5% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 50.5% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 50.5% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 725 aa
294-462

Region 294-462 0 PWM

Residues
169 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF23611 · C2H2 zinc finger PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 294-4621 model
Actions
Predicted = Low TFS_A0A2R8YFL0:294:462_5t0u_A_1 5t0u 294-462 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
266-288PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
294-316PF00096Zinc finger, C2H2 typeoverlaps 294-462
322-345PF00096Zinc finger, C2H2 typeoverlaps 294-462
379-404PF23611C2H2 zinc fingeroverlaps 294-462
437-460PF00096Zinc finger, C2H2 typeoverlaps 294-462
555-573PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions