Transcription factor

A0A386NC20 - TP53

Cellular tumor antigen p53

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 393 aa

5 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3

Motif	Prediction	Source	DNA binding	Support	Actions
MA0106.1	NN 70+%	JASPAR	CCGGACATGCCCGGGCATGT	99.7% identity	Open · Scan
M11197_2.00	NN 70+%	CisBP	AGACATGCCCGGGCATGTCC	99.5% identity	Open · Scan
M03440_2.00	NN 70+%	CisBP	ACATGTCATAGACATGT	77.0% identity	Open · Scan

Nearest Neighbor (70% - 40%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
MA0861.1	NN 70-40%	JASPAR	GACATGTCTGGACATGTC	51.3% identity		Open · Scan
M03438_2.00	NN 70-40%	CisBP	GACATGTCTGGACATGTC	50.1% identity		Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 393 aa

50-65

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 50-651 model

				Actions
Predicted = Low	DIMER_A0A386NC20:50:65_4j19_B_1	4j19	50-65	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
6-30	PF08563	P53 transactivation motif	No overlap with loaded model regions
35-59	PF18521	Transactivation domain 2	overlaps 50-65
100-288	PF00870	P53 DNA-binding domain	No overlap with loaded model regions
319-357	PF07710	P53 tetramerisation motif	No overlap with loaded model regions