ModCRE DB

Transcription factor

A0A386NCU2 - TP53

Cellular tumor antigen p53

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 393 aa

5 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
MA0106.1 NN 70+% JASPAR CCGGACATGCCCGGGCATGT 99.7% identity Open · Scan
M11197_2.00 NN 70+% CisBP AGACATGCCCGGGCATGTCC 99.5% identity Open · Scan
M03440_2.00 NN 70+% CisBP ACATGTCATAGACATGT 77.0% identity Open · Scan
Nearest Neighbor (70% - 40%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA0861.1 NN 70-40% JASPAR GACATGTCTGGACATGTC 51.3% identity Open · Scan
M03438_2.00 NN 70-40% CisBP GACATGTCTGGACATGTC 50.1% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 393 aa
94-355

Region 94-355 0 PWM

Residues
262 aa
Domains
PF00870 · P53 DNA-binding domain PF07710 · P53 tetramerisation motif
3D models
1 active PDB
Templates
3Q05
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 94-3551 model
Actions
Predicted = Low TFS_A0A386NCU2:94:355_3q05_A_1 3q05 94-355 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
6-30PF08563P53 transactivation motifNo overlap with loaded model regions
35-59PF18521Transactivation domain 2No overlap with loaded model regions
100-288PF00870P53 DNA-binding domainoverlaps 94-355
319-357PF07710P53 tetramerisation motifoverlaps 94-355