ModCRE DB

Transcription factor

A0A386NFX3 - TP53

Cellular tumor antigen p53

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 393 aa

5 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
MA0106.1 NN 70+% JASPAR CCGGACATGCCCGGGCATGT 99.7% identity Open · Scan
M11197_2.00 NN 70+% CisBP AGACATGCCCGGGCATGTCC 99.5% identity Open · Scan
M03440_2.00 NN 70+% CisBP ACATGTCATAGACATGT 77.0% identity Open · Scan
Nearest Neighbor (70% - 40%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA0861.1 NN 70-40% JASPAR GACATGTCTGGACATGTC 51.3% identity Open · Scan
M03438_2.00 NN 70-40% CisBP GACATGTCTGGACATGTC 50.1% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 393 aa
50-65

Region 50-65 0 PWM

Residues
16 aa
Domains
PF18521 · Transactivation domain 2
3D models
1 active PDB
Templates
4J19
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 50-651 model
Actions
Predicted = Low DIMER_A0A386NFX3:50:65_4j19_B_1 4j19 50-65 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
6-30PF08563P53 transactivation motifNo overlap with loaded model regions
35-59PF18521Transactivation domain 2overlaps 50-65
100-288PF00870P53 DNA-binding domainNo overlap with loaded model regions
319-357PF07710P53 tetramerisation motifNo overlap with loaded model regions