ModCRE DB

Transcription factor

A0A3B3IRF0 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 669 aa

11 Generated PWM 11 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE11
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:551:610_5i50_B_1 ModCRE Homology model AGGCGACCACCCGGGGGGTGCT Region 551-610 · 1 3D model Open · Scan
TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:11:37_2jx1_A_1 ModCRE Homology model TTAAAAAG Region 11-37 · 1 3D model Open · Scan
TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:12:83_2mf8_A_1 ModCRE Homology model TCTAAAAGTTTTG Region 12-83 · 1 3D model Open · Scan
TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:385:464_2mf8_A_1 ModCRE Homology model TAAAACTTTTTGA Region 385-464 · 1 3D model Open · Scan
TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:386:415_2jx1_A_1 ModCRE Homology model ATTTTTTA Region 386-415 · 1 3D model Open · Scan
a0a3b3irf0.af3.0 ModCRE AlphaFold3 model AAGAGGGTACGTGTTTACCTTAAAAAGGGT AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3irf0.af3.1 ModCRE AlphaFold3 model TCGTGACACACTGTCTTTTGGGAAACCC AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3irf0.af3.2 ModCRE AlphaFold3 model TTTTAACGTACAGCCCGTAGCCCAATAGGA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3irf0.af3.3 ModCRE AlphaFold3 model GGTAGTGGGGTTACCCACCATACATGAAAT AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3irf0.af3.4 ModCRE AlphaFold3 model AGTAGTACAACGTGGGTACGTTAAAAATAT AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3irf0.af3.5 ModCRE AlphaFold3 model AACAGGGTACGTGTTTACCTTAAAAAGGGT AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 669 aa
11-83
385-464
551-610

Region 11-83 2 PWM

Residues
73 aa
Domains
PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type
3D models
2 active PDBs
Templates
2JX1, 2MF8
Sources
Predicted = Low

Region 385-464 2 PWM

Residues
80 aa
Domains
PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type
3D models
2 active PDBs · 2 summary rows
Templates
2JX1, 2MF8
Sources
Predicted = Low

Region 551-610 1 PWM

Residues
60 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
5I50
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
11 active PDB models 2 summary rows
Region 11-832 models
Actions
Predicted = Low TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:11:37_2jx1_A_1 2jx1 11-37 View model · PDB
Predicted = Low TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:12:83_2mf8_A_1 2mf8 12-83 View model · PDB
Region 385-4642 models · 2 summary rows
Actions
Predicted = Low TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:385:464_2mf8_A_1 2mf8 385-464 View model · PDB
Predicted = Low TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:386:415_2jx1_A_1 2jx1 386-415 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 2jx1 385:464 386 415 P:A · DNA:B,C 93.3% / 96.7% 96 View · PDB TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:386:415_2jx1_A_1
1 2mf8 385:464 385 464 P:A · DNA:B,C 68.8% / 76.2% 100 View · PDB TFS_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:385:464_2mf8_A_1
Region 551-6101 model
Actions
Predicted = Low DIMER_tr_A0A3B3IRF0_A0A3B3IRF0_HUMAN:551:610_5i50_B_1 5i50 551-610 View model · PDB
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a3b3irf0.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3irf0.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3irf0.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3irf0.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3irf0.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3irf0.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
11-37PF01530Zinc finger, C2HC typeoverlaps 11-83
55-83PF01530Zinc finger, C2HC typeoverlaps 11-83
127-378PF08474Myelin transcription factor 1No overlap with loaded model regions
388-415PF01530Zinc finger, C2HC typeoverlaps 385-464
436-464PF01530Zinc finger, C2HC typeoverlaps 385-464
490-517PF01530Zinc finger, C2HC typeNo overlap with loaded model regions