Transcription factor

A0A3B3IRT9 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1127 aa

10 Generated PWM 22 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE10

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:860:879_2mf8_A_1	ModCRE	Homology model	TTCTTAAAACT	Region 860-879 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:881:911_2jx1_A_1	ModCRE	Homology model	CTCTTTAA	Region 881-911 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:882:960_2mf8_A_1	ModCRE	Homology model	TAAAACTCTCAGT	Region 882-960 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:907:952_6wmi_A_1	ModCRE	Homology model	TTGTAAAACCGGGG	Region 907-952 · 1 3D model		Open · Scan
a0a3b3irt9.af3.0	ModCRE	AlphaFold3 model	GTTTTAAAACAGTGCTTTGGTGGGCACTTA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irt9.af3.1	ModCRE	AlphaFold3 model	TAAAGCGGGGTAACGCGGTTTTCCCCCCTA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irt9.af3.2	ModCRE	AlphaFold3 model	AGTCAAAATCCCGATAAAAAGATTTTGACG	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irt9.af3.3	ModCRE	AlphaFold3 model	TACTTCCCAAAAAGGGTTGCCCTAAACGTA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irt9.af3.4	ModCRE	AlphaFold3 model	ATTTTTTAATTTTTGCTCATGAGGGGCCTA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irt9.af3.5	ModCRE	AlphaFold3 model	GTTTTAAAACAGTGCTTTGGTGGGCACTTA	AlphaFold3 model · ModCRE PWM		Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1127 aa

860-879

881-960

Region 860-879 1 PWM

Residues

20 aa

Domains

No overlapping PFAM annotation recorded

3D models

1 active PDB

Templates

2MF8

Sources

Predicted = Low

Scan this region Show models

Region 881-960 3 PWM

Residues

80 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

3 active PDBs · 3 summary rows

Templates

2JX1, 2MF8, 6WMI

Sources

Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

22 active PDB models 3 summary rows

Region 860-8791 model

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:860:879_2mf8_A_1	2mf8	860-879	View model · PDB

Region 881-9603 models · 3 summary rows

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:881:911_2jx1_A_1	2jx1	881-911	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:882:960_2mf8_A_1	2mf8	882-960	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:907:952_6wmi_A_1	6wmi	907-952	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	2jx1	881:960	881	911	P:A · DNA:B,C	96.8% / 100.0%	100	View · PDB TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:881:911_2jx1_A_1
1	2mf8	881:960	882	960	P:A · DNA:B,C	68.4% / 74.7%	98	View · PDB TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:882:960_2mf8_A_1
3	6wmi	881:960	907	952	P:A · DNA:E,F	23.9% / 37.0%	31	View · PDB TFS_tr_A0A3B3IRT9_A0A3B3IRT9_HUMAN:907:952_6wmi_A_1

Full sequence / unlocalized models18 models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a3b3irt9.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_dimer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_dimer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_dimer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_dimer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_dimer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_dimer.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_monomer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_monomer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_monomer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_monomer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_monomer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irt9_monomer.af3.5	-	Full sequence / not localized	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
484-510	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
528-556	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
600-851	PF08474	Myelin transcription factor 1	No overlap with loaded model regions
883-911	PF01530	Zinc finger, C2HC type	overlaps 881-960
932-960	PF01530	Zinc finger, C2HC type	overlaps 881-960
986-1013	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions