Transcription factor

A0A3B3IRX5 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1146 aa

10 Generated PWM 22 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE10

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:1003:1032_2jx1_A_1	ModCRE	Homology model	TAAAAAAT	Region 1003-1032 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:1003:1032_2mf8_A_1	ModCRE	Homology model	TGTAAAACTTTTC	Region 1003-1032 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:900:930_2jx1_A_1	ModCRE	Homology model	CGCTTTAA	Region 900-930 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:901:979_2mf8_A_1	ModCRE	Homology model	TAAAACTCTAAGT	Region 901-979 · 1 3D model		Open · Scan
a0a3b3irx5.af3.0	ModCRE	AlphaFold3 model	GGGGCCCCCGGGTGGCCCACACACAGGCCG	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irx5.af3.1	ModCRE	AlphaFold3 model	TTTAAAATTTTGCAAGCACTTCTTGTGCCT	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irx5.af3.2	ModCRE	AlphaFold3 model	GCCACACTTTTTAATAGCTGCGGCGCGGCC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irx5.af3.3	ModCRE	AlphaFold3 model	CACAACATCTTGGCAGTAAAAATTTTCACA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irx5.af3.4	ModCRE	AlphaFold3 model	TCGCAACCCTCTAGTACACGGACGGTCCAT	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3irx5.af3.5	ModCRE	AlphaFold3 model	GGGGCCCCCGGGTGGCCCACCCACAGGCCG	AlphaFold3 model · ModCRE PWM		Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1146 aa

900-979

1003-1032

Region 900-979 2 PWM

Residues

80 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

2 active PDBs · 2 summary rows

Templates

2JX1, 2MF8

Sources

Predicted = Low

Scan this region Show models

Region 1003-1032 2 PWM

Residues

30 aa

Domains

PF01530 · Zinc finger, C2HC type

3D models

2 active PDBs

Templates

2JX1, 2MF8

Sources

Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

22 active PDB models 2 summary rows

Region 900-9792 models · 2 summary rows

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:900:930_2jx1_A_1	2jx1	900-930	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:901:979_2mf8_A_1	2mf8	901-979	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	2jx1	900:979	900	930	P:A · DNA:B,C	96.8% / 100.0%	100	View · PDB TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:900:930_2jx1_A_1
1	2mf8	900:979	901	979	P:A · DNA:B,C	68.4% / 74.7%	98	View · PDB TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:901:979_2mf8_A_1

Region 1003-10322 models

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:1003:1032_2jx1_A_1	2jx1	1003-1032	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IRX5_A0A3B3IRX5_HUMAN:1003:1032_2mf8_A_1	2mf8	1003-1032	View model · PDB

Full sequence / unlocalized models18 models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a3b3irx5.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_dimer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_dimer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_dimer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_dimer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_dimer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_dimer.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_monomer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_monomer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_monomer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_monomer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_monomer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3irx5_monomer.af3.5	-	Full sequence / not localized	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
31-58	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
503-529	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
547-575	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
619-870	PF08474	Myelin transcription factor 1	No overlap with loaded model regions
902-930	PF01530	Zinc finger, C2HC type	overlaps 900-979
951-979	PF01530	Zinc finger, C2HC type	overlaps 900-979
1005-1032	PF01530	Zinc finger, C2HC type	overlaps 1003-1032