Transcription factor

A0A3B3IS61 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1148 aa

8 Generated PWM 11 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE8

Motif	Prediction	Source	DNA binding	Support	Actions
TFS_tr_A0A3B3IS61_A0A3B3IS61_HUMAN:1003:1032_2jx1_A_1	ModCRE	Homology model	TAAAAAAC	Region 1003-1032 · 1 3D model	Open · Scan
TFS_tr_A0A3B3IS61_A0A3B3IS61_HUMAN:1003:1032_2mf8_A_1	ModCRE	Homology model	ATTAAAACTTTTC	Region 1003-1032 · 1 3D model	Open · Scan
a0a3b3is61.af3.0	ModCRE	AlphaFold3 model	AAAGGGGTACGCGTACCCGAGCCCTTATTA	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3is61.af3.1	ModCRE	AlphaFold3 model	CTAAATGATGGGGACCCCGTACAGAAGACC	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3is61.af3.2	ModCRE	AlphaFold3 model	TACTACACCATGTGGCCCACAATGGGCCGG	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3is61.af3.3	ModCRE	AlphaFold3 model	TAAAAAATCATCTTATGAAACGTGGTAATT	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3is61.af3.4	ModCRE	AlphaFold3 model	GTGGTTACGACACGCCCCCCTGAGGGATCA	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3is61.af3.5	ModCRE	AlphaFold3 model	AAAGGGGTACGCGTACCCGAGCCCTTATTA	AlphaFold3 model · ModCRE PWM	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1148 aa

900-979

1003-1032

Scan this region Show models

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

11 active PDB models 3 summary rows

Region 900-9793 models · 3 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	2jx1	900:979	900	930	P:A · DNA:B,C	96.8% / 100.0%	100	View · PDB TFS_tr_A0A3B3IS61_A0A3B3IS61_HUMAN:900:930_2jx1_A_1
1	2mf8	900:979	901	979	P:A · DNA:B,C	68.4% / 74.7%	98	View · PDB TFS_tr_A0A3B3IS61_A0A3B3IS61_HUMAN:901:979_2mf8_A_1
3	6wmi	900:979	926	971	P:A · DNA:E,F	23.9% / 37.0%	31	View · PDB TFS_tr_A0A3B3IS61_A0A3B3IS61_HUMAN:926:971_6wmi_A_1

Region 1003-10322 models

				Actions
Predicted = Low	TFS_tr_A0A3B3IS61_A0A3B3IS61_HUMAN:1003:1032_2jx1_A_1	2jx1	1003-1032	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IS61_A0A3B3IS61_HUMAN:1003:1032_2mf8_A_1	2mf8	1003-1032	View model · PDB

Full sequence / unlocalized models6 models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a3b3is61.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is61.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is61.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is61.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is61.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is61.af3.5	-	Full sequence / not localized	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
31-58	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
503-529	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
547-575	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
619-870	PF08474	Myelin transcription factor 1	No overlap with loaded model regions
902-930	PF01530	Zinc finger, C2HC type	overlaps 900-979
951-979	PF01530	Zinc finger, C2HC type	overlaps 900-979
1005-1032	PF01530	Zinc finger, C2HC type	overlaps 1003-1032