ModCRE DB

Transcription factor

A0A3B3IS71 - RB1

Retinoblastoma-associated protein (pRb)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 923 aa

4 Generated PWM 10 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4roc_A_1 ModCRE Homology model AAAAAAGGTAAAAGCTTTTT Region 60-105 · 1 3D model Open · Scan
TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4rod_A_1 ModCRE Homology model AAAAACGCCAAAAAATTTTA Region 60-105 · 1 3D model Open · Scan
TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8ity_V_1 ModCRE Homology model ATAAAAAGTTTTTGCCAAAA Region 60-105 · 1 3D model Open · Scan
TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8iue_V_1 ModCRE Homology model ACAACAGCTTTCCAAAAA Region 60-105 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 923 aa
60-105

Region 60-105 4 PWM

Residues
46 aa
Domains
No overlapping PFAM annotation recorded
3D models
4 active PDBs · 4 summary rows
Templates
4ROC, 4ROD, 8ITY, 8IUE
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
10 active PDB models 4 summary rows
Region 60-1054 models · 4 summary rows
Actions
Predicted = Low TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4roc_A_1 4roc 60-105 View model · PDB
Predicted = Low TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4rod_A_1 4rod 60-105 View model · PDB
Predicted = Low TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8ity_V_1 8ity 60-105 View model · PDB
Predicted = Low TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8iue_V_1 8iue 60-105 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 8iue 60:105 60 105 P:V · DNA:X,Y 28.3% / 52.2% 12 View · PDB TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8iue_V_1
2 8ity 60:105 60 105 P:V · DNA:X,Y 28.3% / 52.2% 12 View · PDB TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8ity_V_1
3 4rod 60:105 60 105 P:A · DNA:N,T 28.3% / 52.2% 15 View · PDB TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4rod_A_1
4 4roc 60:105 60 105 P:A · DNA:N,T 28.3% / 52.2% 15 View · PDB TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4roc_A_1
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a3b3is71.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
113-226PF11934Domain of unknown function (DUF3452)No overlap with loaded model regions
373-573PF01858Retinoblastoma-associated protein A domainNo overlap with loaded model regions
646-765PF01857Retinoblastoma-associated protein B domainNo overlap with loaded model regions
768-904PF08934Rb C-terminal domainNo overlap with loaded model regions