ModCRE DB

Transcription factor

A0A3B3IS71 - RB1

Retinoblastoma-associated protein (pRb)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 923 aa

4 Generated PWM 10 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4roc_A_1 ModCRE Homology model AAAAAAGGTAAAAGCTTTTT Region 60-105 · 1 3D model Open · Scan
TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4rod_A_1 ModCRE Homology model AAAAACGCCAAAAAATTTTA Region 60-105 · 1 3D model Open · Scan
TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8ity_V_1 ModCRE Homology model ATAAAAAGTTTTTGCCAAAA Region 60-105 · 1 3D model Open · Scan
TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8iue_V_1 ModCRE Homology model ACAACAGCTTTCCAAAAA Region 60-105 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 923 aa
60-105

Region 60-105 4 PWM

Residues
46 aa
Domains
No overlapping PFAM annotation recorded
3D models
4 active PDBs · 4 summary rows
Templates
4ROC, 4ROD, 8ITY, 8IUE
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
10 active PDB models 4 summary rows
Region 60-1054 models · 4 summary rows
Actions
Predicted = Low TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4roc_A_1 4roc 60-105 View model · PDB
Predicted = Low TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4rod_A_1 4rod 60-105 View model · PDB
Predicted = Low TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8ity_V_1 8ity 60-105 View model · PDB
Predicted = Low TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8iue_V_1 8iue 60-105 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 8iue 60:105 60 105 P:V · DNA:X,Y 28.3% / 52.2% 12 View · PDB TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8iue_V_1
2 8ity 60:105 60 105 P:V · DNA:X,Y 28.3% / 52.2% 12 View · PDB TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_8ity_V_1
3 4rod 60:105 60 105 P:A · DNA:N,T 28.3% / 52.2% 15 View · PDB TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4rod_A_1
4 4roc 60:105 60 105 P:A · DNA:N,T 28.3% / 52.2% 15 View · PDB TFS_tr_A0A3B3IS71_A0A3B3IS71_HUMAN:60:105_4roc_A_1
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a3b3is71.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3is71.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
113-226PF11934Domain of unknown function (DUF3452)No overlap with loaded model regions
373-573PF01858Retinoblastoma-associated protein A domainNo overlap with loaded model regions
646-765PF01857Retinoblastoma-associated protein B domainNo overlap with loaded model regions
768-904PF08934Rb C-terminal domainNo overlap with loaded model regions