Transcription factor

A0A3B3IS77 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 982 aa

13 Generated PWM 25 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE13

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
DIMER_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:900:961_5i50_B_1	ModCRE	Homology model	CTGCGCACACGTGTGTGCCCGG	Region 900-961 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:337:363_2jx1_A_1	ModCRE	Homology model	TTAAAAAG	Region 337-363 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:338:409_2mf8_A_1	ModCRE	Homology model	TTTAAAAGTTTTA	Region 338-409 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:734:764_2jx1_A_1	ModCRE	Homology model	GTCTTTAA	Region 734-764 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:735:813_2mf8_A_1	ModCRE	Homology model	TAAAACTTTCAGT	Region 735-813 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:760:805_6wmi_A_1	ModCRE	Homology model	TTGTAAAACCGGGG	Region 760-805 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:900:961_5i50_B_1	ModCRE	Homology model	TTGCTCATGATTCGTGCC	Region 900-961 · 1 3D model		Open · Scan
a0a3b3is77.af3.0	ModCRE	AlphaFold3 model	TTATAATAAGTACCCTTTTAAGGGTATGAA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3is77.af3.1	ModCRE	AlphaFold3 model	TTTTTGCGACTAATTTTAAAGTACCACTAA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3is77.af3.2	ModCRE	AlphaFold3 model	AAACGCGCGAATAACCGTGTGACGATGTCC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3is77.af3.3	ModCRE	AlphaFold3 model	TGTTGCTGCACATTTTTGTGAATTCGGGCT	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3is77.af3.4	ModCRE	AlphaFold3 model	AAAACAGTGTAAAAACGTTGACCTCCTTTC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3is77.af3.5	ModCRE	AlphaFold3 model	TTATAATAAGTACCCTTTTAAGGGTATGAA	AlphaFold3 model · ModCRE PWM		Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 982 aa

337-409

734-813

900-961

Region 337-409 2 PWM

Residues

73 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

2 active PDBs

Templates

2JX1, 2MF8

Sources

Predicted = Low

Scan this region Show models

Region 734-813 3 PWM

Residues

80 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

3 active PDBs · 3 summary rows

Templates

2JX1, 2MF8, 6WMI

Sources

Predicted = Low

Scan this region Show models

Region 900-961 2 PWM

Residues

62 aa

Domains

No overlapping PFAM annotation recorded

3D models

2 active PDBs · 1 summary row

Templates

5I50

Sources

Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

25 active PDB models 4 summary rows

Region 337-4092 models

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:337:363_2jx1_A_1	2jx1	337-363	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:338:409_2mf8_A_1	2mf8	338-409	View model · PDB

Region 734-8133 models · 3 summary rows

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:734:764_2jx1_A_1	2jx1	734-764	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:735:813_2mf8_A_1	2mf8	735-813	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:760:805_6wmi_A_1	6wmi	760-805	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	2jx1	734:813	734	764	P:A · DNA:B,C	96.8% / 100.0%	100	View · PDB TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:734:764_2jx1_A_1
1	2mf8	734:813	735	813	P:A · DNA:B,C	68.4% / 74.7%	98	View · PDB TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:735:813_2mf8_A_1
3	6wmi	734:813	760	805	P:A · DNA:E,F	23.9% / 37.0%	31	View · PDB TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:760:805_6wmi_A_1

Region 900-9612 models · 1 summary row

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	DIMER_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:900:961_5i50_B_1	5i50	900-961	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:900:961_5i50_B_1	5i50	900-961	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
4	5i50	734:813	900	961	P:B · DNA:C,D	27.4% / 53.2%	63	View · PDB TFS_tr_A0A3B3IS77_A0A3B3IS77_HUMAN:900:961_5i50_B_1

Full sequence / unlocalized models18 models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a3b3is77.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_dimer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_dimer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_dimer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_dimer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_dimer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_dimer.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_monomer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_monomer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_monomer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_monomer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_monomer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3is77_monomer.af3.5	-	Full sequence / not localized	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
337-363	PF01530	Zinc finger, C2HC type	overlaps 337-409
381-409	PF01530	Zinc finger, C2HC type	overlaps 337-409
453-704	PF08474	Myelin transcription factor 1	No overlap with loaded model regions
736-764	PF01530	Zinc finger, C2HC type	overlaps 734-813
785-813	PF01530	Zinc finger, C2HC type	overlaps 734-813
839-866	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions