ModCRE DB

Transcription factor

A0A3B3ISB6 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 754 aa

8 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE8
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_A0A3B3ISB6_A0A3B3ISB6_HUMAN:335:361_2jx1_A_1 ModCRE Homology model TTAAAAAG Region 335-361 · 1 3D model Open · Scan
TFS_tr_A0A3B3ISB6_A0A3B3ISB6_HUMAN:336:407_2mf8_A_1 ModCRE Homology model TTTAAAAGTTTTA Region 336-407 · 1 3D model Open · Scan
a0a3b3isb6.af3.0 ModCRE AlphaFold3 model GGGCCCCCGTACGACTACAGGAAAATCGTT AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isb6.af3.1 ModCRE AlphaFold3 model CACTCTTAAGTACTACCCAGCAGTGCCCGG AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isb6.af3.2 ModCRE AlphaFold3 model AAATTTTTGGGTCTACAACGGGACGTCGTC AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isb6.af3.3 ModCRE AlphaFold3 model GGGGCACCCCGCGTGTATCCTAGGGGGGCC AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isb6.af3.4 ModCRE AlphaFold3 model GGGCCGCCGTACGACTACAGGAAAATCGTT AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isb6.af3.5 ModCRE AlphaFold3 model GCGCAGGAAATTTTTCATACGGCAGGGCCA AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 754 aa
335-407

Region 335-407 2 PWM

Residues
73 aa
Domains
PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type
3D models
2 active PDBs · 2 summary rows
Templates
2JX1, 2MF8
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 2 summary rows
Region 335-4072 models · 2 summary rows
Actions
Predicted = Low TFS_tr_A0A3B3ISB6_A0A3B3ISB6_HUMAN:335:361_2jx1_A_1 2jx1 335-361 View model · PDB
Predicted = Low TFS_tr_A0A3B3ISB6_A0A3B3ISB6_HUMAN:336:407_2mf8_A_1 2mf8 336-407 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 2jx1 335:407 335 361 P:A · DNA:B,C 81.5% / 88.9% 87 View · PDB TFS_tr_A0A3B3ISB6_A0A3B3ISB6_HUMAN:335:361_2jx1_A_1
1 2mf8 335:407 336 407 P:A · DNA:B,C 63.9% / 73.6% 96 View · PDB TFS_tr_A0A3B3ISB6_A0A3B3ISB6_HUMAN:336:407_2mf8_A_1
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a3b3isb6.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isb6.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isb6.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isb6.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isb6.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isb6.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
335-361PF01530Zinc finger, C2HC typeoverlaps 335-407
379-407PF01530Zinc finger, C2HC typeoverlaps 335-407
451-702PF08474Myelin transcription factor 1No overlap with loaded model regions