Transcription factor

A0A3B3ISI4 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 516 aa

9 Generated PWM 12 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE9

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
DIMER_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:386:423_5t01_B_1	ModCRE	Homology model	CCGTTAAAGTTATCCGGG	Region 386-423 · 1 3D model		Open · Scan
DIMER_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:391:450_5i50_B_1	ModCRE	Homology model	ACGCGACCACCCGGGGGGTGCT	Region 391-450 · 1 3D model		Open · Scan
TFS_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:204:223_2mf8_A_1	ModCRE	Homology model	TTCTTAAAACT	Region 204-223 · 1 3D model		Open · Scan
a0a3b3isi4.af3.0	ModCRE	AlphaFold3 model	TGGCCGCGCCCGGTGGTACTACGTACTACA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isi4.af3.1	ModCRE	AlphaFold3 model	TGGCCGCGCCCGGTGGTACTACGTACTACA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isi4.af3.2	ModCRE	AlphaFold3 model	CCCTTTAAGTGAGGTACTTAGGGCGGCCGC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isi4.af3.3	ModCRE	AlphaFold3 model	AACTGAGTACGTAGGTCACCCGTCCCCGA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isi4.af3.4	ModCRE	AlphaFold3 model	AAAAGGGGGTAAGAAACTAGGTTACCTACC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isi4.af3.5	ModCRE	AlphaFold3 model	TGGGTTGTGGGTGACCCCCTGGGACCCCT	AlphaFold3 model · ModCRE PWM		Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 516 aa

204-223

225-304

386-450

Region 204-223 1 PWM

Residues

20 aa

Domains

No overlapping PFAM annotation recorded

3D models

1 active PDB

Templates

2MF8

Sources

Predicted = Low

Scan this region Show models

Region 225-304 0 PWM

Residues

80 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

3 active PDBs · 3 summary rows

Templates

2JX1, 2MF8, 6WMI

Sources

Predicted = Low

Scan this region Show models

Region 386-450 2 PWM

Residues

65 aa

Domains

No overlapping PFAM annotation recorded

3D models

2 active PDBs

Templates

5I50, 5T01

Sources

Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

12 active PDB models 3 summary rows

Region 204-2231 model

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:204:223_2mf8_A_1	2mf8	204-223	View model · PDB

Region 225-3043 models · 3 summary rows

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:225:255_2jx1_A_1	2jx1	225-255	View model · PDB
Predicted = Low	TFS_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:226:304_2mf8_A_1	2mf8	226-304	View model · PDB
Predicted = Low	TFS_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:251:296_6wmi_A_1	6wmi	251-296	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	2jx1	225:304	225	255	P:A · DNA:B,C	96.8% / 100.0%	100	View · PDB TFS_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:225:255_2jx1_A_1
1	2mf8	225:304	226	304	P:A · DNA:B,C	68.4% / 74.7%	98	View · PDB TFS_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:226:304_2mf8_A_1
3	6wmi	225:304	251	296	P:A · DNA:E,F	23.9% / 37.0%	31	View · PDB TFS_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:251:296_6wmi_A_1

Region 386-4502 models

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	DIMER_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:386:423_5t01_B_1	5t01	386-423	View model · PDB
Predicted = Low	DIMER_tr_A0A3B3ISI4_A0A3B3ISI4_HUMAN:391:450_5i50_B_1	5i50	391-450	View model · PDB

Full sequence / unlocalized models6 models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a3b3isi4.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isi4.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isi4.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isi4.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isi4.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isi4.af3.5	-	Full sequence / not localized	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
2-195	PF08474	Myelin transcription factor 1	No overlap with loaded model regions
227-255	PF01530	Zinc finger, C2HC type	overlaps 225-304
276-304	PF01530	Zinc finger, C2HC type	overlaps 225-304
330-357	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions