ModCRE DB

Transcription factor

A0A3B3ISN3 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 824 aa

12 Generated PWM 12 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE12
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:742:803_5i50_B_1 ModCRE Homology model TTGCGCACACGTGTGTGCACAC Region 742-803 · 1 3D model Open · Scan
TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:179:205_2jx1_A_1 ModCRE Homology model TTAAAAAG Region 179-205 · 1 3D model Open · Scan
TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:180:251_2mf8_A_1 ModCRE Homology model TTTAAAAGTTTGA Region 180-251 · 1 3D model Open · Scan
TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:576:606_2jx1_A_1 ModCRE Homology model CGCTTTAA Region 576-606 · 1 3D model Open · Scan
TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:577:655_2mf8_A_1 ModCRE Homology model TAAAACTTTAAGT Region 577-655 · 1 3D model Open · Scan
TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:742:803_5i50_B_1 ModCRE Homology model GTGGCGCACCACGTGTGCTCAA Region 742-803 · 1 3D model Open · Scan
a0a3b3isn3.af3.0 ModCRE AlphaFold3 model CTACAGTGTAGTACTCAATTAATAAAGTAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isn3.af3.1 ModCRE AlphaFold3 model GGACGCGTTGCAAGTGGACGCGGTGCAAAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isn3.af3.2 ModCRE AlphaFold3 model GGGGCGTCTACCGACGCGCACGTGGGGCCA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isn3.af3.3 ModCRE AlphaFold3 model GGTAAACCTTTTTCCAAGTACCCCCATGGG AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isn3.af3.4 ModCRE AlphaFold3 model AGGGGGCGCCCTTTGCAAATGCTGGCATAT AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3isn3.af3.5 ModCRE AlphaFold3 model CTACAGTGTAGTACTCAATTAATAAAGTAA AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 824 aa
179-251
576-655
742-803

Region 179-251 2 PWM

Residues
73 aa
Domains
PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type
3D models
2 active PDBs
Templates
2JX1, 2MF8
Sources
Predicted = Low
Scan this region Show models

Region 576-655 2 PWM

Residues
80 aa
Domains
PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type
3D models
2 active PDBs · 2 summary rows
Templates
2JX1, 2MF8
Sources
Predicted = Low
Scan this region Show models

Region 742-803 2 PWM

Residues
62 aa
Domains
No overlapping PFAM annotation recorded
3D models
2 active PDBs · 2 summary rows
Templates
5I50
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
12 active PDB models 4 summary rows
Region 179-2512 models
Actions
Predicted = Low TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:179:205_2jx1_A_1 2jx1 179-205 View model · PDB
Predicted = Low TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:180:251_2mf8_A_1 2mf8 180-251 View model · PDB
Region 576-6552 models · 2 summary rows
Actions
Predicted = Low TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:576:606_2jx1_A_1 2jx1 576-606 View model · PDB
Predicted = Low TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:577:655_2mf8_A_1 2mf8 577-655 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 2jx1 576:655 576 606 P:A · DNA:B,C 96.8% / 100.0% 100 View · PDB TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:576:606_2jx1_A_1
1 2mf8 576:655 577 655 P:A · DNA:B,C 68.4% / 74.7% 98 View · PDB TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:577:655_2mf8_A_1
Region 742-8032 models · 2 summary rows
Actions
Predicted = Low DIMER_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:742:803_5i50_B_1 5i50 742-803 View model · PDB
Predicted = Low TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:742:803_5i50_B_1 5i50 742-803 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 5i50 576:655 742,742 803,803 P:A,B · DNA:C,D 27.4% / 53.2% 66,63 View · PDB DIMER_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:742:803_5i50_B_1
3 5i50 576:655 742,742 803,803 P:A,B · DNA:C,D 27.4% / 53.2% 66,63 View · PDB TFS_tr_A0A3B3ISN3_A0A3B3ISN3_HUMAN:742:803_5i50_B_1
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a3b3isn3.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isn3.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isn3.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isn3.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isn3.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3isn3.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
31-58PF01530Zinc finger, C2HC typeNo overlap with loaded model regions
179-205PF01530Zinc finger, C2HC typeoverlaps 179-251
223-251PF01530Zinc finger, C2HC typeoverlaps 179-251
295-546PF08474Myelin transcription factor 1No overlap with loaded model regions
578-606PF01530Zinc finger, C2HC typeoverlaps 576-655
627-655PF01530Zinc finger, C2HC typeoverlaps 576-655
681-708PF01530Zinc finger, C2HC typeNo overlap with loaded model regions