Transcription factor

A0A3B3ISP2 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 859 aa

8 Generated PWM 11 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE8

Motif	Prediction	Source	DNA binding	Support	Actions
TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:837:858_2jx1_A_1	ModCRE	Homology model	AAAAAAAG	Region 837-858 · 1 3D model	Open · Scan
TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:837:858_2mf8_A_1	ModCRE	Homology model	TTAAAAAGTTTTG	Region 837-858 · 1 3D model	Open · Scan
a0a3b3isp2.af3.0	ModCRE	AlphaFold3 model	GGGTCTACGGGCGCGCACCGCGCGCGCGCC	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3isp2.af3.1	ModCRE	AlphaFold3 model	GGCGGTACACACTTGGTGGAATCCGTTGGA	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3isp2.af3.2	ModCRE	AlphaFold3 model	ATGGGCGCGTATGTGTGCCAAATGGGGGCC	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3isp2.af3.3	ModCRE	AlphaFold3 model	AAAAGTTGTGGTTGTACAGTACCCGTATAG	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3isp2.af3.4	ModCRE	AlphaFold3 model	TCTTCTCGAACGTCGCACGCGCCCCCGGTC	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a3b3isp2.af3.5	ModCRE	AlphaFold3 model	GGGTCTACGGGCGCGCACCGCGCGCGCGCC	AlphaFold3 model · ModCRE PWM	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 859 aa

734-813

837-858

Scan this region Show models

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

11 active PDB models 3 summary rows

Region 734-8133 models · 3 summary rows

				Actions
Predicted = Low	TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:734:764_2jx1_A_1	2jx1	734-764	View model · PDB
Predicted = Low	TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:735:813_2mf8_A_1	2mf8	735-813	View model · PDB
Predicted = Low	TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:758:791_6a57_A_1	6a57	758-791	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	2jx1	734:813	734	764	P:A · DNA:B,C	96.8% / 100.0%	100	View · PDB TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:734:764_2jx1_A_1
1	2mf8	734:813	735	813	P:A · DNA:B,C	68.4% / 74.7%	98	View · PDB TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:735:813_2mf8_A_1
3	6a57	734:813	758	791	P:A · DNA:B,C	29.4% / 47.1%	25	View · PDB TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:758:791_6a57_A_1

Region 837-8582 models

				Actions
Predicted = Low	TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:837:858_2jx1_A_1	2jx1	837-858	View model · PDB
Predicted = Low	TFS_tr_A0A3B3ISP2_A0A3B3ISP2_HUMAN:837:858_2mf8_A_1	2mf8	837-858	View model · PDB

Full sequence / unlocalized models6 models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a3b3isp2.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isp2.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isp2.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isp2.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isp2.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isp2.af3.5	-	Full sequence / not localized	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
337-363	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
381-409	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
453-704	PF08474	Myelin transcription factor 1	No overlap with loaded model regions
736-764	PF01530	Zinc finger, C2HC type	overlaps 734-813
785-813	PF01530	Zinc finger, C2HC type	overlaps 734-813
839-858	PF01530	Zinc finger, C2HC type	overlaps 837-858