Transcription factor

A0A3B3ISW5 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1143 aa

10 Generated PWM 22 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE10

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:505:531_2jx1_A_1	ModCRE	Homology model	TTAAAAAG	Region 505-531 · 1 3D model		Open · Scan
TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:506:577_2mf8_A_1	ModCRE	Homology model	TTTAAAAGTTTTT	Region 506-577 · 1 3D model		Open · Scan
TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:902:932_2jx1_A_1	ModCRE	Homology model	TTAAATAG	Region 902-932 · 1 3D model		Open · Scan
TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:903:981_2mf8_A_1	ModCRE	Homology model	TCTTAAAGTTTTA	Region 903-981 · 1 3D model		Open · Scan
a0a3b3isw5.af3.0	ModCRE	AlphaFold3 model	ACAATTTCACCCTTTTTGGGAAACGTGGGC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isw5.af3.1	ModCRE	AlphaFold3 model	ACAATTTCACCCTTTTTGGGAAACGTGGGC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isw5.af3.2	ModCRE	AlphaFold3 model	GGAGCGGCCACCCCGGTGTCGGAACCTCTT	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isw5.af3.3	ModCRE	AlphaFold3 model	ATAAAAAAATTGTATGTAAATTTTATTTTT	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isw5.af3.4	ModCRE	AlphaFold3 model	GGCTTTCTGGAACCTCTGTCGGTTGTTGCT	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3isw5.af3.5	ModCRE	AlphaFold3 model	CCCCGCGGTTTAAAAAATTTGGGCGCGCGG	AlphaFold3 model · ModCRE PWM		Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1143 aa

505-577

902-981

Region 505-577 2 PWM

Residues

73 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

2 active PDBs

Templates

2JX1, 2MF8

Sources

Predicted = Low

Scan this region Show models

Region 902-981 2 PWM

Residues

80 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

2 active PDBs · 2 summary rows

Templates

2JX1, 2MF8

Sources

Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

22 active PDB models 2 summary rows

Region 505-5772 models

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:505:531_2jx1_A_1	2jx1	505-531	View model · PDB
Predicted = Low	TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:506:577_2mf8_A_1	2mf8	506-577	View model · PDB

Region 902-9812 models · 2 summary rows

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:902:932_2jx1_A_1	2jx1	902-932	View model · PDB
Predicted = Low	TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:903:981_2mf8_A_1	2mf8	903-981	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	2jx1	902:981	902	932	P:A · DNA:B,C	96.8% / 100.0%	100	View · PDB TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:902:932_2jx1_A_1
1	2mf8	902:981	903	981	P:A · DNA:B,C	68.4% / 74.7%	98	View · PDB TFS_tr_A0A3B3ISW5_A0A3B3ISW5_HUMAN:903:981_2mf8_A_1

Full sequence / unlocalized models18 models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a3b3isw5.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_dimer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_dimer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_dimer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_dimer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_dimer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_dimer.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_monomer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_monomer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_monomer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_monomer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_monomer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3isw5_monomer.af3.5	-	Full sequence / not localized	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
31-58	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
505-531	PF01530	Zinc finger, C2HC type	overlaps 505-577
549-577	PF01530	Zinc finger, C2HC type	overlaps 505-577
621-872	PF08474	Myelin transcription factor 1	No overlap with loaded model regions
904-932	PF01530	Zinc finger, C2HC type	overlaps 902-981
953-981	PF01530	Zinc finger, C2HC type	overlaps 902-981
1007-1034	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions