ModCRE DB

Transcription factor

A0A3B3ITJ8 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1185 aa

9 Generated PWM 21 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE9
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_A0A3B3ITJ8_A0A3B3ITJ8_HUMAN:901:931_2jx1_A_1 ModCRE Homology model TTAAAGAG Region 901-931 · 1 3D model Open · Scan
TFS_tr_A0A3B3ITJ8_A0A3B3ITJ8_HUMAN:902:980_2mf8_A_1 ModCRE Homology model TCTGAAAGTTTTA Region 902-980 · 1 3D model Open · Scan
TFS_tr_A0A3B3ITJ8_A0A3B3ITJ8_HUMAN:927:972_6wmi_A_1 ModCRE Homology model TTGTAAAACCGGGG Region 927-972 · 1 3D model Open · Scan
a0a3b3itj8.af3.0 ModCRE AlphaFold3 model TAAGTGGCATGGAACACTTGCCGGAGGCTA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3itj8.af3.1 ModCRE AlphaFold3 model AAGTACAGTGCCGGTGGTGATGTCTCTTTA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3itj8.af3.2 ModCRE AlphaFold3 model TAAGTGGCATGGAACACTTGCCGGAGGCTA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3itj8.af3.3 ModCRE AlphaFold3 model AACATTTTTGAGGGGGTTACAAAATTTAAT AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3itj8.af3.4 ModCRE AlphaFold3 model TTAGAGGTTACCCAGTATACACTACTCGTA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3itj8.af3.5 ModCRE AlphaFold3 model CCGGCCGTTCCGCTCTCGAGAATTTTTGGG AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1185 aa
901-980

Region 901-980 3 PWM

Residues
80 aa
Domains
PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type
3D models
3 active PDBs · 3 summary rows
Templates
2JX1, 2MF8, 6WMI
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
21 active PDB models 3 summary rows
Region 901-9803 models · 3 summary rows
Actions
Predicted = Low TFS_tr_A0A3B3ITJ8_A0A3B3ITJ8_HUMAN:901:931_2jx1_A_1 2jx1 901-931 View model · PDB
Predicted = Low TFS_tr_A0A3B3ITJ8_A0A3B3ITJ8_HUMAN:902:980_2mf8_A_1 2mf8 902-980 View model · PDB
Predicted = Low TFS_tr_A0A3B3ITJ8_A0A3B3ITJ8_HUMAN:927:972_6wmi_A_1 6wmi 927-972 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 2jx1 901:980 901 931 P:A · DNA:B,C 96.8% / 100.0% 100 View · PDB TFS_tr_A0A3B3ITJ8_A0A3B3ITJ8_HUMAN:901:931_2jx1_A_1
1 2mf8 901:980 902 980 P:A · DNA:B,C 68.4% / 74.7% 98 View · PDB TFS_tr_A0A3B3ITJ8_A0A3B3ITJ8_HUMAN:902:980_2mf8_A_1
3 6wmi 901:980 927 972 P:A · DNA:E,F 23.9% / 37.0% 31 View · PDB TFS_tr_A0A3B3ITJ8_A0A3B3ITJ8_HUMAN:927:972_6wmi_A_1
Full sequence / unlocalized models18 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a3b3itj8.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8.af3.5-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_dimer.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_dimer.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_dimer.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_dimer.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_dimer.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_dimer.af3.5-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_monomer.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_monomer.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_monomer.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_monomer.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_monomer.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3itj8_monomer.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
31-58PF01530Zinc finger, C2HC typeNo overlap with loaded model regions
504-530PF01530Zinc finger, C2HC typeNo overlap with loaded model regions
548-576PF01530Zinc finger, C2HC typeNo overlap with loaded model regions
620-871PF08474Myelin transcription factor 1No overlap with loaded model regions
903-931PF01530Zinc finger, C2HC typeoverlaps 901-980
952-980PF01530Zinc finger, C2HC typeoverlaps 901-980
1006-1033PF01530Zinc finger, C2HC typeNo overlap with loaded model regions