Transcription factor

A0A3B3ITL3 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 860 aa

10 Generated PWM 22 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE10

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:179:205_2jx1_A_1	ModCRE	Homology model	TTAAAAAG	Region 179-205 · 1 3D model		Open · Scan
TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:180:251_2mf8_A_1	ModCRE	Homology model	TTTAAAAGTTTTT	Region 180-251 · 1 3D model		Open · Scan
TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:576:606_2jx1_A_1	ModCRE	Homology model	CTCTTTAA	Region 576-606 · 1 3D model		Open · Scan
TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:577:655_2mf8_A_1	ModCRE	Homology model	TAAAACTCTCAGT	Region 577-655 · 1 3D model		Open · Scan
a0a3b3itl3.af3.0	ModCRE	AlphaFold3 model	TAATTTATGTGGGGACTCACAAAAAACCCC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3itl3.af3.1	ModCRE	AlphaFold3 model	GCACAGGTGGTTTTTTGGCCCATTGACTAA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3itl3.af3.2	ModCRE	AlphaFold3 model	CCGCCAGAGGTACTTGCGACCTGTGAGGTC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3itl3.af3.3	ModCRE	AlphaFold3 model	GTACATGGGTACAACATGTTATCATGGCTA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3itl3.af3.4	ModCRE	AlphaFold3 model	TCTCTCATCATAGATGTCCCACAAATGGGA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3itl3.af3.5	ModCRE	AlphaFold3 model	TAATTTACGTGGGGACTCACAAAAAACCTC	AlphaFold3 model · ModCRE PWM		Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 860 aa

179-251

576-655

Region 179-251 2 PWM

Residues

73 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

2 active PDBs

Templates

2JX1, 2MF8

Sources

Predicted = Low

Scan this region Show models

Region 576-655 2 PWM

Residues

80 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

2 active PDBs · 2 summary rows

Templates

2JX1, 2MF8

Sources

Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

22 active PDB models 2 summary rows

Region 179-2512 models

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:179:205_2jx1_A_1	2jx1	179-205	View model · PDB
Predicted = Low	TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:180:251_2mf8_A_1	2mf8	180-251	View model · PDB

Region 576-6552 models · 2 summary rows

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:576:606_2jx1_A_1	2jx1	576-606	View model · PDB
Predicted = Low	TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:577:655_2mf8_A_1	2mf8	577-655	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	2jx1	576:655	576	606	P:A · DNA:B,C	96.8% / 100.0%	100	View · PDB TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:576:606_2jx1_A_1
1	2mf8	576:655	577	655	P:A · DNA:B,C	68.4% / 74.7%	98	View · PDB TFS_tr_A0A3B3ITL3_A0A3B3ITL3_HUMAN:577:655_2mf8_A_1

Full sequence / unlocalized models18 models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a3b3itl3.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_dimer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_dimer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_dimer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_dimer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_dimer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_dimer.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_monomer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_monomer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_monomer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_monomer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_monomer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3itl3_monomer.af3.5	-	Full sequence / not localized	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
31-58	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
179-205	PF01530	Zinc finger, C2HC type	overlaps 179-251
223-251	PF01530	Zinc finger, C2HC type	overlaps 179-251
295-546	PF08474	Myelin transcription factor 1	No overlap with loaded model regions
578-606	PF01530	Zinc finger, C2HC type	overlaps 576-655
627-655	PF01530	Zinc finger, C2HC type	overlaps 576-655
681-708	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions