ModCRE DB

Transcription factor

A0A3B3IU66 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 739 aa

9 Generated PWM 9 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE9
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_A0A3B3IU66_A0A3B3IU66_HUMAN:28:60_2mf8_A_1 ModCRE Homology model TTAAAATTTTTAA Region 28-60 · 1 3D model Open · Scan
TFS_tr_A0A3B3IU66_A0A3B3IU66_HUMAN:31:58_2jx1_A_1 ModCRE Homology model CTTTTTCA Region 31-58 · 1 3D model Open · Scan
TFS_tr_A0A3B3IU66_A0A3B3IU66_HUMAN:696:731_2mf8_A_1 ModCRE Homology model CAAGGAACTTTCA Region 696-731 · 1 3D model Open · Scan
a0a3b3iu66.af3.0 ModCRE AlphaFold3 model CCACGGGCGTGACACATTTATATATAAAAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3iu66.af3.1 ModCRE AlphaFold3 model CCACGGGCGTGACACATTTATATATAAAAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3iu66.af3.2 ModCRE AlphaFold3 model AGGTTGTTGCACGCTGGCAGATGAAAGAG AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3iu66.af3.3 ModCRE AlphaFold3 model GGATTTTTAAAACCACGTCCCGGCACGCCT AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3iu66.af3.4 ModCRE AlphaFold3 model GCGGGGCCCGCGCGGGTGCCCC AlphaFold3 model · ModCRE PWM Open · Scan
a0a3b3iu66.af3.5 ModCRE AlphaFold3 model CCGGGGTGCGCAGGGGTCTTCACTTTA AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 739 aa
28-60
696-731

Region 28-60 2 PWM

Residues
33 aa
Domains
PF01530 · Zinc finger, C2HC type
3D models
2 active PDBs · 2 summary rows
Templates
2JX1, 2MF8
Sources
Predicted = Low
Scan this region Show models

Region 696-731 1 PWM

Residues
36 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
2MF8
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
9 active PDB models 2 summary rows
Region 28-602 models · 2 summary rows
Actions
Predicted = Low TFS_tr_A0A3B3IU66_A0A3B3IU66_HUMAN:28:60_2mf8_A_1 2mf8 28-60 View model · PDB
Predicted = Low TFS_tr_A0A3B3IU66_A0A3B3IU66_HUMAN:31:58_2jx1_A_1 2jx1 31-58 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 2jx1 28:60 31 58 P:A · DNA:B,C 75.0% / 85.7% 90 View · PDB TFS_tr_A0A3B3IU66_A0A3B3IU66_HUMAN:31:58_2jx1_A_1
1 2mf8 28:60 28 60 P:A · DNA:B,C 72.7% / 84.8% 44 View · PDB TFS_tr_A0A3B3IU66_A0A3B3IU66_HUMAN:28:60_2mf8_A_1
Region 696-7311 model
Actions
Predicted = Low TFS_tr_A0A3B3IU66_A0A3B3IU66_HUMAN:696:731_2mf8_A_1 2mf8 696-731 View model · PDB
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a3b3iu66.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3iu66.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3iu66.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3iu66.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3iu66.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a3b3iu66.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
31-58PF01530Zinc finger, C2HC typeoverlaps 28-60
485-687PF08474Myelin transcription factor 1No overlap with loaded model regions