Transcription factor

A0A3B3IUE2 - MYT1L

Myelin transcription factor 1 like

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 973 aa

8 Generated PWM 23 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE8

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:835:864_2jx1_A_1	ModCRE	Homology model	TAAAAAAT	Region 835-864 · 1 3D model		Open · Scan
TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:835:864_2mf8_A_1	ModCRE	Homology model	GGTAAAACTTTTC	Region 835-864 · 1 3D model		Open · Scan
a0a3b3iue2.af3.0	ModCRE	AlphaFold3 model	GGACCACAAAGGGTGAGGGCATTACTCCAG	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3iue2.af3.1	ModCRE	AlphaFold3 model	AACCGACGGCAACGAGTCTCCGCCCCGGCC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3iue2.af3.2	ModCRE	AlphaFold3 model	GTTGAAAATTTTCGTTAATGTCTTAAAAAC	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3iue2.af3.3	ModCRE	AlphaFold3 model	GGACCACAAAGGGTGAGGGCATTACTCCAG	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3iue2.af3.4	ModCRE	AlphaFold3 model	TTTTTTTTAAGTGTTACCAACGGGGCCCCA	AlphaFold3 model · ModCRE PWM		Open · Scan
a0a3b3iue2.af3.5	ModCRE	AlphaFold3 model	GTATACAGTGCGCCCGCGTGGGTGACCCGC	AlphaFold3 model · ModCRE PWM		Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 973 aa

732-811

835-864

Region 732-811 0 PWM

Residues

80 aa

Domains

PF01530 · Zinc finger, C2HC type PF01530 · Zinc finger, C2HC type

3D models

3 active PDBs · 3 summary rows

Templates

2JX1, 2MF8, 6WMI

Sources

Predicted = Low

Scan this region Show models

Region 835-864 2 PWM

Residues

30 aa

Domains

PF01530 · Zinc finger, C2HC type

3D models

2 active PDBs

Templates

2JX1, 2MF8

Sources

Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

23 active PDB models 3 summary rows

Region 732-8113 models · 3 summary rows

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:732:762_2jx1_A_1	2jx1	732-762	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:733:811_2mf8_A_1	2mf8	733-811	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:758:803_6wmi_A_1	6wmi	758-803	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	2jx1	732:811	732	762	P:A · DNA:B,C	96.8% / 100.0%	100	View · PDB TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:732:762_2jx1_A_1
1	2mf8	732:811	733	811	P:A · DNA:B,C	68.4% / 74.7%	98	View · PDB TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:733:811_2mf8_A_1
3	6wmi	732:811	758	803	P:A · DNA:E,F	23.9% / 37.0%	31	View · PDB TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:758:803_6wmi_A_1

Region 835-8642 models

Source ↕	Model ↕	Template ↕	Residues modeled ↕	Actions
Predicted = Low	TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:835:864_2jx1_A_1	2jx1	835-864	View model · PDB
Predicted = Low	TFS_tr_A0A3B3IUE2_A0A3B3IUE2_HUMAN:835:864_2mf8_A_1	2mf8	835-864	View model · PDB

Full sequence / unlocalized models18 models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a3b3iue2.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_dimer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_dimer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_dimer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_dimer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_dimer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_dimer.af3.5	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_monomer.af3.0	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_monomer.af3.1	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_monomer.af3.2	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_monomer.af3.3	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_monomer.af3.4	-	Full sequence / not localized	View model · PDB
Predicted = Low	a0a3b3iue2_monomer.af3.5	-	Full sequence / not localized	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
335-361	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
379-407	PF01530	Zinc finger, C2HC type	No overlap with loaded model regions
451-702	PF08474	Myelin transcription factor 1	No overlap with loaded model regions
734-762	PF01530	Zinc finger, C2HC type	overlaps 732-811
783-811	PF01530	Zinc finger, C2HC type	overlaps 732-811
837-864	PF01530	Zinc finger, C2HC type	overlaps 835-864