Transcription factor

A0A7I2V380 - STAT5A

Signal transducer and activator of transcription

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 777 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M11356_2.00	Known	CisBP	TTCCCAGAATTGCGTTTCCTAGAG	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 777 aa

238-686

Residues: 449 aa
Domains: PF01017 · STAT transcription factor, coiled-coil domain PF02864 · STAT protein, DNA binding domain PF21354 · Signal transducer and activator of transcription, linker domain PF00017 · SH2 domain
3D models: 1 active PDB
Templates: 4Y5W
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 238-6861 model

				Actions
Predicted = Low	DIMER_A0A7I2V380:238:686_4y5w_A_1	4y5w	238-686	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
1-106	PF02865	STAT protein, protein interaction domain	No overlap with loaded model regions
129-307	PF01017	STAT transcription factor, coiled-coil domain	overlaps 238-686
319-452	PF02864	STAT protein, DNA binding domain	overlaps 238-686
475-557	PF21354	Signal transducer and activator of transcription, linker domain	overlaps 238-686
578-652	PF00017	SH2 domain	overlaps 238-686