Transcription factor

A0A7I2V4N2 - NONO

Non-POU domain-containing octamer-binding protein

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 360 aa

4 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE4

Motif	Prediction	Source	DNA binding	Support	Actions
a0a7i2v4n2.af3.0	ModCRE	AlphaFold3 model	TGGGGGCGCGCGTCGTACATTTTTTTT	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a7i2v4n2.af3.1	ModCRE	AlphaFold3 model	AGTGGTGCGCCGTGGTAAGGTGGCAACC	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a7i2v4n2.af3.4	ModCRE	AlphaFold3 model	AAAAAAAAAGTATACGTCGGTCGCCCC	AlphaFold3 model · ModCRE PWM	Open · Scan
a0a7i2v4n2.af3.5	ModCRE	AlphaFold3 model	TGGGGGCGCGCGTCGTACATTTTTTTT	AlphaFold3 model · ModCRE PWM	Open · Scan

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	a0a7i2v4n2.af3.0	-	Full sequence	View model · PDB
Predicted = Low	a0a7i2v4n2.af3.1	-	Full sequence	View model · PDB
Predicted = Low	a0a7i2v4n2.af3.2	-	Full sequence	View model · PDB
Predicted = Low	a0a7i2v4n2.af3.3	-	Full sequence	View model · PDB
Predicted = Low	a0a7i2v4n2.af3.4	-	Full sequence	View model · PDB
Predicted = Low	a0a7i2v4n2.af3.5	-	Full sequence	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.