Region 333-364 0 PWM
- Residues
- 32 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 1 active PDB
- Templates
- 1KB4
- Sources
- Structure model
Transcription factor
A0A7P0MRW0 - NONO
Non-POU domain-containing octamer-binding protein
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 515 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07693_2.00 | NN 70+% | CisBP | CTCCTGTGTGTGCCTTGGCTG | 80.7% identity | Open · Scan |
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
515 aa
333-364
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 333-3641 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_A0A7P0MRW0:333:364_1kb4_B_1 | 1kb4 | 333-364 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 76-140 | PF00076 | RNA recognition motif | No overlap with loaded model regions |
| 150-210 | PF00076 | RNA recognition motif | No overlap with loaded model regions |
| 221-272 | PF08075 | NOPS (NUC059) domain | No overlap with loaded model regions |