ModCRE DB

Transcription factor

A0A804HIS1 - DEAF1

DEAF1 transcription factor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 323 aa

9 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07544_2.00 NN 70-40% CisBP CACGAA 67.2% identity Open · Scan
ModCRE8
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_A0A804HIS1_A0A804HIS1_HUMAN:262:310_3cbb_A_1 ModCRE Homology model AAGGATAAAATACCAAAATT Region 262-310 · 1 3D model Open · Scan
TFS_tr_A0A804HIS1_A0A804HIS1_HUMAN:262:310_3cbb_A_1 ModCRE Homology model AAAGACAAAATACCAAAATT Region 262-310 · 1 3D model Open · Scan
a0a804his1.af3.0 ModCRE AlphaFold3 model TCAGGGCGGCGCACATGAAAAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a804his1.af3.1 ModCRE AlphaFold3 model GCAATCATACATAATGACCGCGGCGAGATG AlphaFold3 model · ModCRE PWM Open · Scan
a0a804his1.af3.2 ModCRE AlphaFold3 model GCAGGGTAACAAAGATGAGGAT AlphaFold3 model · ModCRE PWM Open · Scan
a0a804his1.af3.3 ModCRE AlphaFold3 model TGACACATCCGGTGCCAGGTAT AlphaFold3 model · ModCRE PWM Open · Scan
a0a804his1.af3.4 ModCRE AlphaFold3 model TCAGGCATGCAAAGAGAAGGAGACCCCATT AlphaFold3 model · ModCRE PWM Open · Scan
a0a804his1.af3.5 ModCRE AlphaFold3 model TCAGGGCGGCGCACATGAAAAA AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 323 aa
262-310

Region 262-310 2 PWM

Residues
49 aa
Domains
PF01753 · MYND finger
3D models
2 active PDBs · 2 summary rows
Templates
3CBB
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 2 summary rows
Region 262-3102 models · 2 summary rows
Actions
Predicted = Low DIMER_tr_A0A804HIS1_A0A804HIS1_HUMAN:262:310_3cbb_A_1 3cbb 262-310 View model · PDB
Predicted = Low TFS_tr_A0A804HIS1_A0A804HIS1_HUMAN:262:310_3cbb_A_1 3cbb 262-310 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 3cbb 262:310 262,262 310,310 P:A,B · DNA:C,D 28.6% / 40.8% 64,62 View · PDB DIMER_tr_A0A804HIS1_A0A804HIS1_HUMAN:262:310_3cbb_A_1
1 3cbb 262:310 262,262 310,310 P:A,B · DNA:C,D 28.6% / 40.8% 64,62 View · PDB TFS_tr_A0A804HIS1_A0A804HIS1_HUMAN:262:310_3cbb_A_1
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a804his1.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a804his1.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a804his1.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a804his1.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a804his1.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a804his1.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
2-30PF01342SAND domainNo overlap with loaded model regions
262-298PF01753MYND fingeroverlaps 262-310