ModCRE DB

Transcription factor

A0A8C8KI72 - MEN1

Menin

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 607 aa

6 Generated PWM 7 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
a0a8c8ki72.af3.0 ModCRE AlphaFold3 model TGACTGGGGGGAAGGCCCCGG AlphaFold3 model · ModCRE PWM Open · Scan
a0a8c8ki72.af3.1 ModCRE AlphaFold3 model GTTTTTTAGCAAACAGG AlphaFold3 model · ModCRE PWM Open · Scan
a0a8c8ki72.af3.2 ModCRE AlphaFold3 model TAAATTAACGT AlphaFold3 model · ModCRE PWM Open · Scan
a0a8c8ki72.af3.3 ModCRE AlphaFold3 model CCCGGTGGGCCACGCAAACGCA AlphaFold3 model · ModCRE PWM Open · Scan
a0a8c8ki72.af3.4 ModCRE AlphaFold3 model TGACTGGGGGGAAGGCCCCGG AlphaFold3 model · ModCRE PWM Open · Scan
a0a8c8ki72.af3.5 ModCRE AlphaFold3 model AGGAAACGA AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 607 aa
2-584

Region 2-584 0 PWM

Residues
583 aa
Domains
PF05053 · Menin PF05053 · Menin
3D models
1 active PDB · 1 summary row
Templates
8GPN
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
7 active PDB models 1 summary row
Region 2-5841 model · 1 summary row
Actions
Predicted = Low TFS_tr_A0A8C8KI72_A0A8C8KI72_HUMAN:2:584_8gpn_K_1 8gpn 2-584 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 8gpn 2:584 2 584 P:K · DNA:I,J 76.5% / 76.5% 99 View · PDB TFS_tr_A0A8C8KI72_A0A8C8KI72_HUMAN:2:584_8gpn_K_1
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a8c8ki72.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8c8ki72.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8c8ki72.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8c8ki72.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8c8ki72.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8c8ki72.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
3-496PF05053Meninoverlaps 2-584
545-605PF05053Meninoverlaps 2-584