ModCRE DB

Transcription factor

A0A8I5KRB5 - ZBTB11

Zinc finger and BTB domain containing 11

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 911 aa

11 Generated PWM 12 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M06083_2.00 NN 70-40% CisBP CCCCCACCCCACAGTAACAAAAAC 56.2% identity Open · Scan
ModCRE10
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:566:840_5wjq_D_1 ModCRE Homology model CCAACAGTGCTTGTCCCCCCCCCCAGGG Region 566-840 · 1 3D model Open · Scan
TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:569:842_5v3j_E_1 ModCRE Homology model CCATTTAACTGCAAAGCCCCCGGCC Region 569-842 · 1 3D model Open · Scan
TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:569:842_5v3m_C_1 ModCRE Homology model GGGGCCGCCCTCCCCCCGCCCCGGGG Region 569-842 · 1 3D model Open · Scan
TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:697:840_2i13_A_1 ModCRE Homology model GGTAAGAGGGAGATTAATAAC Region 697-840 · 1 3D model Open · Scan
a0a8i5krb5.af3.0 ModCRE AlphaFold3 model GTCCGCCGCATCGTTCCCCACGCCCCAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a8i5krb5.af3.1 ModCRE AlphaFold3 model AAAGGCGGGCGCGCAACTTCGGCCGGAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a8i5krb5.af3.2 ModCRE AlphaFold3 model GTCCGCCGCATCGTTCCCCACGCCCCAA AlphaFold3 model · ModCRE PWM Open · Scan
a0a8i5krb5.af3.3 ModCRE AlphaFold3 model TTCACCGCGCCGCACCGCCCCGCGCATG AlphaFold3 model · ModCRE PWM Open · Scan
a0a8i5krb5.af3.4 ModCRE AlphaFold3 model AGTTTTGGTCAATCCGACCTCGGGA AlphaFold3 model · ModCRE PWM Open · Scan
a0a8i5krb5.af3.5 ModCRE AlphaFold3 model GGGGTTCGGGGCGCCCCCGAAACGGCGC AlphaFold3 model · ModCRE PWM Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 911 aa
566-879

Region 566-879 4 PWM

Residues
314 aa
Domains
PF13912 · C2H2-type zinc finger PF13912 · C2H2-type zinc finger PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
12 active PDB models 6 summary rows
Region 566-8796 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:705:753_1llm_D_1 1llm 705-753 View model · PDB
Predicted = Low TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:566:840_5wjq_D_1 5wjq 566-840 View model · PDB
Predicted = Low TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:569:842_5v3j_E_1 5v3j 569-842 View model · PDB
Predicted = Low TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:569:842_5v3m_C_1 5v3m 569-842 View model · PDB
Predicted = Low TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:570:879_7w1m_H_1 7w1m 570-879 View model · PDB
Predicted = Low TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:697:840_2i13_A_1 2i13 697-840 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 2i13 566:879 697 840 P:A · DNA:C,D 36.8% / 52.8% 91 View · PDB TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:697:840_2i13_A_1
1 1llm 566:879 705,705 753,753 P:C,D · DNA:A,B 36.7% / 55.1% 56,57 View · PDB DIMER_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:705:753_1llm_D_1
2 5v3m 566:879 569 842 P:C · DNA:A,B 33.0% / 46.7% 97 View · PDB TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:569:842_5v3m_C_1
3 5v3j 566:879 569 842 P:E · DNA:A,B 33.0% / 46.7% 97 View · PDB TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:569:842_5v3j_E_1
1 5wjq 566:879 566 840 P:D · DNA:A,B 31.0% / 43.7% 96 View · PDB TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:566:840_5wjq_D_1
4 7w1m 566:879 570 879 P:H · DNA:F,G 29.5% / 42.5% 94 View · PDB TFS_tr_A0A8I5KRB5_A0A8I5KRB5_HUMAN:570:879_7w1m_H_1
Full sequence / unlocalized models6 models
SourceModelTemplateResidues modeledActions
Predicted = Lowa0a8i5krb5.af3.0-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8i5krb5.af3.1-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8i5krb5.af3.2-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8i5krb5.af3.3-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8i5krb5.af3.4-Full sequence / not localizedView model · PDB
Predicted = Lowa0a8i5krb5.af3.5-Full sequence / not localizedView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
68-121PF17921Integrase zinc binding domainNo overlap with loaded model regions
204-306PF00651BTB/POZ domainNo overlap with loaded model regions
569-593PF13912C2H2-type zinc fingeroverlaps 566-879
597-620PF13912C2H2-type zinc fingeroverlaps 566-879
651-673PF13912C2H2-type zinc fingeroverlaps 566-879
679-701PF00096Zinc finger, C2H2 typeoverlaps 566-879
707-729PF00096Zinc finger, C2H2 typeoverlaps 566-879
735-759PF13912C2H2-type zinc fingeroverlaps 566-879
766-788PF00096Zinc finger, C2H2 typeoverlaps 566-879
822-846PF00096Zinc finger, C2H2 typeoverlaps 566-879
859-880PF00096Zinc finger, C2H2 typeoverlaps 566-879