Transcription factor

A0A8Q3SIZ8 - IRF2

Interferon regulatory factor 2

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 125 aa

6 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3

Motif	Prediction	Source	DNA binding	Support	Actions
MA0051.1	NN 70+%	JASPAR	GGAAAGCGAAACCAAAAC	98.3% identity	Open · Scan
M09245_2.00	NN 70+%	CisBP	GAAAGTGAAAGTGAAAGTAA	96.7% identity	Open · Scan
MA0050.1	NN 70+%	JASPAR	GAAAGCGAAACC	71.2% identity	Open · Scan

Nearest Neighbor (70% - 40%)3

Motif	Prediction	Source	DNA binding	Support	Actions
M00177_2.00	NN 70-40%	CisBP	AACCGAAACT	51.6% identity	Open · Scan
M05537_2.00	NN 70-40%	CisBP	CCGAAACCGAAACT	50.5% identity	Open · Scan
MA1420.1	NN 70-40%	JASPAR	CCGAAACCGAAACT	50.5% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 125 aa

7-112

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 7-1121 model

				Actions
Predicted = Low	DIMER_A0A8Q3SIZ8:7:112_1t2k_A_1	1t2k	7-112	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
7-112	PF00605	Interferon regulatory factor transcription factor	overlaps 7-112