ModCRE DB

Transcription factor

A0AAA9YHR6 - ZNF436

Zinc finger protein 436

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 452 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M08887_2.00 Known CisBP CCTCCTCCAGGAAGCCTTCCCTGA Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 452 aa
120-280

Region 120-280 0 PWM

Residues
161 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 120-2801 model
Actions
Predicted = Low TFS_A0AAA9YHR6:120:280_5t0u_A_1 5t0u 120-280 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
1-36PF01352KRAB boxNo overlap with loaded model regions
120-142PF00096Zinc finger, C2H2 typeoverlaps 120-280
148-170PF00096Zinc finger, C2H2 typeoverlaps 120-280
176-198PF00096Zinc finger, C2H2 typeoverlaps 120-280
204-226PF00096Zinc finger, C2H2 typeoverlaps 120-280
232-254PF00096Zinc finger, C2H2 typeoverlaps 120-280
260-282PF00096Zinc finger, C2H2 typeoverlaps 120-280
288-310PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
316-338PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
344-366PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
372-394PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
400-422PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
428-450PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions