Region 60-105 4 PWM
- Residues
- 46 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 4 active PDBs · 4 summary rows
- Templates
- 4ROD, 4ROE, 8ITY, 8IUE
- Sources
- Predicted = Low
Transcription factor
A0AAQ5BH24 - RB1
Retinoblastoma-associated protein (pRb)
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 877 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE4
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_4rod_A_1 | ModCRE | Homology model | TAAAATTTTTTGGCCATAAA | Region 60-105 · 1 3D model | Open · Scan | |
| TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_4roe_A_1 | ModCRE | Homology model | AAAAACCTTTTCTAAATTT | Region 60-105 · 1 3D model | Open · Scan | |
| TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_8ity_V_1 | ModCRE | Homology model | ATAAAAAGTTTTTGCCAAAA | Region 60-105 · 1 3D model | Open · Scan | |
| TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_8iue_V_1 | ModCRE | Homology model | ACAACAGCTTTCCAAAAA | Region 60-105 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
877 aa
60-105
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
10 active PDB models
4 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 60-1054 models · 4 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_4rod_A_1 | 4rod | 60-105 | View model · PDB |
| Predicted = Low | TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_4roe_A_1 | 4roe | 60-105 | View model · PDB |
| Predicted = Low | TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_8ity_V_1 | 8ity | 60-105 | View model · PDB |
| Predicted = Low | TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_8iue_V_1 | 8iue | 60-105 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 1 | 8iue | 60:105 | 60 | 105 | P:V · DNA:X,Y | 28.3% / 52.2% | 12 | View · PDB TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_8iue_V_1 |
| 2 | 8ity | 60:105 | 60 | 105 | P:V · DNA:X,Y | 28.3% / 52.2% | 12 | View · PDB TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_8ity_V_1 |
| 3 | 4roe | 60:105 | 60 | 105 | P:A · DNA:N,T | 28.3% / 52.2% | 14 | View · PDB TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_4roe_A_1 |
| 4 | 4rod | 60:105 | 60 | 105 | P:A · DNA:N,T | 28.3% / 52.2% | 15 | View · PDB TFS_tr_A0AAQ5BH24_A0AAQ5BH24_HUMAN:60:105_4rod_A_1 |
Full sequence / unlocalized models6 models
| Source | Model | Template | Residues modeled | Actions |
|---|---|---|---|---|
| Predicted = Low | a0aaq5bh24.af3.0 | - | Full sequence / not localized | View model · PDB |
| Predicted = Low | a0aaq5bh24.af3.1 | - | Full sequence / not localized | View model · PDB |
| Predicted = Low | a0aaq5bh24.af3.2 | - | Full sequence / not localized | View model · PDB |
| Predicted = Low | a0aaq5bh24.af3.3 | - | Full sequence / not localized | View model · PDB |
| Predicted = Low | a0aaq5bh24.af3.4 | - | Full sequence / not localized | View model · PDB |
| Predicted = Low | a0aaq5bh24.af3.5 | - | Full sequence / not localized | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 113-226 | PF11934 | Domain of unknown function (DUF3452) | No overlap with loaded model regions |
| 373-573 | PF01858 | Retinoblastoma-associated protein A domain | No overlap with loaded model regions |
| 757-874 | PF08934 | Rb C-terminal domain | No overlap with loaded model regions |