ModCRE DB

Transcription factor

A0AAQ5BHS1 - HIVEP1

Zinc finger protein 40

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 2516 aa

21 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M06068_2.00 NN 70+% CisBP GGGAATCCCCT 76.1% identity Open · Scan
Nearest Neighbor (70% - 40%)20
MotifPredictionSourceDNA bindingSupportLogoActions
M04590_2.00 NN 70-40% CisBP TGCGCTAACCATTGC 53.0% identity Open · Scan
M08859_2.00 NN 70-40% CisBP CATTTTTTCCTCCTAGGCCT 52.9% identity Open · Scan
M07761_2.00 NN 70-40% CisBP CTGATTATTCACCCA 51.9% identity Open · Scan
M10303_2.00 NN 70-40% CisBP TACTGGGAATACC 51.8% identity Open · Scan
MA1508.1 NN 70-40% JASPAR GAAACAGGAAGT 51.8% identity Open · Scan
M07650_2.00 NN 70-40% CisBP GGTCTATAAAAGGGGGGCCGCGGGGGGG 50.9% identity Open · Scan
M08239_2.00 NN 70-40% CisBP GGGCCGCTCTAGGCTGCCGG 50.9% identity Open · Scan
M08320_2.00 NN 70-40% CisBP TTCCCTGCC 50.9% identity Open · Scan
M08395_2.00 NN 70-40% CisBP GCTGCCTACTCTTCC 50.9% identity Open · Scan
M00780_2.00 NN 70-40% CisBP GACCCCCCGG 50.0% identity Open · Scan
M01181_2.00 NN 70-40% CisBP GCGCATCCCC 50.0% identity Open · Scan
M07714_2.00 NN 70-40% CisBP AGCCCATTGGGGCCTATGCCC 50.0% identity Open · Scan
M08233_2.00 NN 70-40% CisBP CCCCTGCTGGG 50.0% identity Open · Scan
M09013_2.00 NN 70-40% CisBP GGCCCCCTGCTGTGA 50.0% identity Open · Scan
MA0696.1 NN 70-40% JASPAR GACCCCCCGCTGTG 50.0% identity Open · Scan
MA0697.1 NN 70-40% JASPAR GACCCCCCGCTGCGC 50.0% identity Open · Scan
MA0751.1 NN 70-40% JASPAR GACCCCCCGCTGTGC 50.0% identity Open · Scan
MA1584.1 NN 70-40% JASPAR CGACCCCCCGCTGTGC 50.0% identity Open · Scan
MA1628.1 NN 70-40% JASPAR CACAGCAGGGG 50.0% identity Open · Scan
MA1655.1 NN 70-40% JASPAR GGGAACAGCCAC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 2516 aa
204-254

Region 204-254 0 PWM

Residues
51 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 204-2541 model
Actions
Predicted = Low TFS_A0AAQ5BHS1:204:254_5egb_A_1 5egb 204-254 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
232-254PF00096Zinc finger, C2H2 typeoverlaps 204-254
1886-1908PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
1914-1938PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions